Kits, Chemicals and Consumables etc.

Department of Pediatrics Kits, Chemicals & Reagents Name

CRP (50 ml x 1)

CRP Slide (25 test)

Urea ( 2 x 100 ml)

Creatinine (2 x 100 ml 2 x 100 ml)

Bilirubin T+D

SGOT (100 ml)

SGPT (100 ml)

Alkaline phosPhatase (100 ml)

Glucose (2 x 500 ml)

Calcium (1 x 50 ml)

Printer paper ( Thermal) (57 mm size)

Sodium hypochlorite (5 ltr)

Tips – Small (5-100 ul)

Tips – 1 ml ( big )

Micropipette – 1 ml (Variable)

Micropippete 50 ul (Fix size)

Micropippete 10 ul (Fix size)

Department of Microbiology CHEMICALS

Readymade Sheep Blood Agar * (50 Plate per pack)

Readymade Sheep Chocolate Agar* (50 Plate per pack)

Nutrient Agar (500 gm Pack)

Nutrient Broth (100 gm Pack)

Glucose Phosphate Broth (100 gm Pack)

Mac Conkey Agar (500 gm Pack)

Muller Hinton Agar (500 gm Pack)

Sabroud Dextrose Agar with Chloramphenicol (100 gm Pack)

Simmon's Citrate Agar (100 gm Pack)

Cristensens Urea Agar Base (100 gm Pack)

Robertson Cooked Media with meat particles (500 gm Pack)

Thioglycolate Broth (100 gm Pack)

Brain Heart Infusion Broth (500 gm Pack)

Columbia blood agar base (500 gm Pack)

CLED Agar with indicator bromothymol blue (500 gm Pack)

Peptone Water (100 gm Pack)

Triple Sugar Iron Agar (100 gm Pack)

Salmonella Shigella Agar (100 gm Pack)

Cary Blair Medium Base (100 gm Pack)

TCBS Agar (100 gm Pack)

Bile Salt Agar (100 gm Pack)

PPA Agar (100 gm Pack)

Bile Esculin Agar (100 gm Pack)

Cetrimide Agar (100 gm Pack)

Selenite F. Broth (100 gm Pack)

Water culture test kit for coliforms (1 pack )

Oxidase Reagent (tetra-methyl-p- phenylenediamine dihydrochloride) (25 gm)

Safaranine (25 gms pack size)

Gram Staining Kit (Crystal Violet + Gram Iodine + Acetone/Alcohol + Safrannine) (125 ml x 4)

Acid Fast Staining Kit (Carbol Fuschin + Methylene Blue + 20% H2SO4 (125 ml x 3)

Alcohol 70% (500 ml each)

Acetone (500 ml each)

Methanol (500 ml each)

Albert Staining Kit (Albert A + Albert B) (125 ml each)

Ferric Chloride (500 ml )

Glucose Powder / Crystals (100 gm Pack)

Lactose Powder / Crystals (100 gm Pack)

Mannitol Power / Crystals (100 gm Pack)

Sucrose Powder / Crystals (100 gm Pack)

Maltose Powder / Crystals (100 gm Pack)

DMSO (500 ml)

MR Reagent (125 ml )

Indole Reagent (125 ml)

Lead Acetate (100 gm Pack)

Cedar Wood Oil (125 ml)

Hot Air Oven Tape ( ml)

Autoclave Tape (127 ml)

DPX Mount (100 - 200 ml)

Salmonella Poly O (Antisera) (2 ml)

Salmonella 02,04,09 (Antisera) (2 ml)

Salmonella dH/iH(Antisera) (2 ml)

Vibrio Cholera Poly O (Antisera) (2 ml)

Vibrio Cholera Non O 1(Antisera) (2 ml)

Vibrio Cholera Ogawa (Antisera) (2 ml)

Vibrio Cholera Inaba(Antisera) (2 ml)

Shigella Antisera (Poly) (Type A,B,C, & D) (2 ml Each)

Shigella dysentriae Antisera (Type A) (2 ml)

Shigella flexneri Antisera (Type B) (2 ml)

Amikacin (30 mcg) (50 - 100 Disc per pack )

Imipenem (10 mcg) (50 - 100 Disc per pack )

Co-Trimoxazole (Sulpha/Trimethoprim) 25 mcg (23.75 / 1.25) (50 - 100 Disc per pack )

Netillin (Netilmicin Sulphate) (30 mcg) (50 - 100 Disc per pack)

Doxycycline Hydrochloride (30 mcg) (50 - 100 Disc per pack )

Vancomycin (30 mcg) (50 - 100 Disc per pack )

Chloramphenicol (30 mcg) (50 - 100 Disc per pack )

Nitrofurantoin (300 mcg) (50 - 100 Disc per pack )

Nalidixic Acid (30 mcg) (50 - 100 Disc per pack )

Amoxyclav (Amoxycillin/ Clavulanic acid) 20/10 mcg (50 - 100 Disc per pack )

Tetracycline (30 mcg) (50 - 100 Disc per pack )

Gentamicin (10 mcg) (50 - 100 Disc per pack )

Ciprofloxacin (5 mcg) (50 - 100 Disc per pack )

Ceftriaxone (30 mcg) (50 - 100 Disc per pack )

Cefuroxime (30 mcg) (50 - 100 Disc per pack )

Cefoperazone/Sulbactam 75/30mcg (50 - 100 Disc per pack )

Linezolid (30 mcg) (50 - 100 Disc per pack )

Aztreonam (30 mcg) (50 - 100 Disc per pack )

Teicoplanin (30 mcg) (50 - 100 Disc per pack )

Meropenem (10 mcg) (50 - 100 Disc per pack )

Norfloxacin (10 mcg) (50 - 100 Disc per pack )

Azithromycin (15 mcg) (50 - 100 Disc per pack )

Colistin (10 mcg) (50 - 100 Disc per pack )

Cefoperazone (75 mcg) (50 - 100 Disc per pack )

Piperacillin/Tazobactam (100/10 mcg) (50 - 100 Disc per pack )

Levofloxacin (5 mcg) (50 - 100 Disc per pack )

Erythromycin (15 mcg) (50 - 100 Disc per pack )

Ceftazidime (30 mcg) (50 - 100 Disc per pack )

Clindamycin (2 mcg) (50 - 100 Disc per pack )

Novobiocin (5 mcg) (50 - 100 Disc per pack )

Cefotaxime (30 mcg) (50 - 100 Disc per pack )

Cefoxitin (30 mcg) (50 - 100 Disc per pack )

Ceftazidime / Clavulanic acid (30/10 mcg) (50 - 100 Disc per pack )

ONPG (Nitrocefine) Disc (50 Disc pack)

Optochin (5 mcg) (50 - 100 Disc per pack )

Bacitracin (10 mcg) (50 - 100 Disc per pack )

Ampicillin (10 mcg) (50 - 100 Disc per pack )

Penicillin (10 units) (50 - 100 Disc per pack )

Oxacillin (1 mcg) (50 - 100 Disc per pack )

Cefazolin (30 mcg) (50 - 100 Disc per pack )

Ertapenem (10 mcg) (50 - 100 Disc per pack )

Cefepime (30 mcg) (50 - 100 Disc per pack )

Vancomycin (E-Strip for MIC) (50 Strip per pack)

Imipenem (E-Strip for MIC) (50 Strip per pack)

Colistin (E-Strip for MIC) (50 Strip per pack)

Sodium polyanethol sulphonate (50 Strip per pack)

High level gentamicin (120 mcg) (50 - 100 Disc per pack )

High level streptomycin (300 mcg) (50 - 100 Disc per pack )

Minocycline (50 - 100 Disc per pack )

Cornmeal Agar (100 gm )

SS Agar (100 gm )

DCA Agar (500 gm)

XLD Agar (500 gm)

Yeast Nitrogen Agar (100 gm )

Chorme Agar (100 gm)

Dextrose Peptone (500 gm)

Bufeord G. Borth (100 gm)

CC Supplement (5 Vial)

Mannitol Motility Medium (100 gm)

Barrit Reagent A for (VP) test (1 Bottle)

Barrit Reagent B for (VP) test (1 Bottle)

Teicoplanin E-Strip (50 Strip per pack)

Cefotaxime E-Strip (50 Strip per pack)

Carbohydrate assimilation disks for Candia spp identification (50 Strip per pack)

Dermatophyte test medium (100 gm)

Corn meal agar (100 gm)

Hugh leifson sugars (glucose,lactose, maltose, sucrose, Mannitol) (100 gm)

Cation Adjusted Mueller Hinton Broth (500 gm)

Pottassium nitrate broth (500 gm)

Zinc dust (100 gm)

Alpha naphtholamine (1 Bottle)

Sulfanilic acid (1 Bottle)

Phosphatase agar (100 gm)

Liquid ammonia (1 Bottle)

Furazolidone disc 100mcg (50 - 100 Disc per pack )

Nihydrin solution (1 Bottle)

Ribose disk /powder (100 gm)

Trehalose powder (100 gm)

Andrades indicator (100 gm)

Malachite green powder (100 gm)

Calcoflour white (100 gm)

Auramine stain (100 gm)

Xylose Lysine Deoxycholate Agar (100 gm)

Bromothymol blue indicator (100 gm)

Arabinose powder (100 gm)

Gelatinase medium (100 gm)

NaCl (100 gm)

Vancomycin Screen Agar (100 gm)

* Defibrinated Sheep Blood (In batches as per requirement)

Enterococcus faecalis ATCC 29212 (1 Strip)

Escherichia coli ATCC 35218 (1 Strip)

Klebsiella pneumoniae ATCC 700603 (1 Strip)

Escherichia coli NCTC 13353 (1 Strip)

Klebsiella pneumoniae ATCC BAA-1705 (1 Strip)

Klebsiella pneumoniae ATCC BAA-2814 (1 Strip)

Acinetobacter baumanni NCTC - 13304 (1 Strip)

Bowie Dick Tape (Indicator for autoclave) (1 Pack)

Spore Strip (Geobacillus stearothermophilus indicator for autoclave) (1 Pack)

Department of Microbiology KITS

Malaria Antigen (50 Test per pack) U

A.S.O. Titre (100 Test per pack)

R.A. Factor (100 Test per pack)

CRP Test (100 Test per pack)

HBsAg Card Test (100 Test per pack)

HBsAg ELISA (96 Well per pack)

RPR (Card Test) (100 Test per pack)

T. pallidum Haemagglutination Assay Test (48/96 well per kit)

TORCH IgM & IgG Detection Card Test (Individually Packed/test)

TORCH IgM ELISA (Toxoplasma + Rubella + CMV + Herpes 1 & 2) (96 well each parameter per kit )

TORCH IgG ELISA (Toxoplasma + Rubella + CMV + Herpes 1 & 2) (96 well each parameter per kit)

Meningitis Antigen Detection Kit (Individually Packed/test)

Anti HCV Antibody Card Test (Individually Packed/test)

Anti HCV ELISA (96 well per kit)

HAV (IgM) ELISA (96 well per kit)

HEV (IgM) ELISA (96 well per kit)

Syphcard with accessories (Individually Packed/test)

Widal Tube Test (4 x 125 ml with positive & negative control)

Widal Slide Test (4 x 125 ml with positive & negative control)

Dengue IgM Antibody Card Test (Individually Packed/test)

NS1 Dengue Antigen Card Test (Individually Packed/test)

Typhoid Rapit Test (Antibodies Card Test) (Individually Packed/test)

Dengue IgM (96 well per kit)

Chikungunya IgM (96 well per kit)

Chikumgunya IgM Card Test (100 per pack)

Clostridium Difficile Toxin A and B ELISA Kit (96 well per kit)

Clostridium Difficile Toxin A and B Rapid card test (100 per pack)

Meningitis Antigen Detection Kit (600 Card per pack)

Colistin MIC testing Kit (96 well per kit)

PCP immunofluoresence Kit

Streptococcal grouping kit A,B,C,D

Department of Microbiology GLASSWARE

Beaker Borosilicate Glass (2 ltrs.)

Test Tube without rim Borosil glass (18 x 150 mm)

Test Tube without rim Borosil glass (15 x 150 mm)

Borosil screwcap autoclavable bottle 250 ml

Borosil screwcap autoclavable bottle 500 ml

Borosil screwcap autoclavable bottle 1 ltr

Borosil screwcap autoclavable bottle 2 Ltrs

Glass Bottle (125 ml) with screwcap

Glass Rods

Glass Petridises 90 mm

Cover Slip 18 mm

Cover Slip 40 mm

Durhams Tubes (100 x 10)

Dreyers Tubes (100 x 10)

Felix Tubes (100 x 10)

Micro Pipette tips 5-200 ml (1000 per pack)

Micro Pipette tips 5-300 ml (1000 per pack)

Micro Pipette tips 100-1000 0ml (500 per pack)

Droping Bottle 30 ml

Collection tube Polystrene 5 ml (100 per Pack)

Collection tube Polystrene 10 ml (100 per Pack)

Serum Storage vial 2 ml with screwcap (O Ring) (100 per Pack)

Universal container sterile 30 ml (100 per Pack)

Sterile swab stick individually packed in polythene (100 per Pack)

Sterile swab stick in a poly propelene sterile screwcap tube (100 per Pack)

Eppendorf Tubes 1.8 ml (100 per Pack)

Eppendorf Tubes 0.5 ml (100 per Pack)

Autoclavable Petridises 90 mm (PACK)

Autoclavable Petridises 110 mm (PACK)

N-95 Mask (PACK)

Disposable mask triple layer (50-100 per pack)

Latex Gloves Pair 6⁡ ½ No (50 Pair per pack)

Latex Gloves Pair 7 No (50 Pair per pack)

Latex Gloves Pair 7 ½ No (50 Pair per pack)

Tissue Paper roll (6 Roll per pack)

Disposable 5 ml Syringe with 23 guaze Needle

Disposable 2 ml Syringe with 23 guaze Needle (100 Per Pack (Individually Pack)

Test Tube Holder (for Test tube size 18 x 150 mm) (Per Pack)

Widal Tube Stand (Per Pack)

Proof Sprit (5 Ltrs)

Handwash (Liquid Soap) (5 Ltrs)

Sterilium (Hand Sanitizer) (500 Ml)

Ordinary Filter Paper Sheet (46x57cm) (250-300 sheet per box)

Whatman Filter Paper No.1

Liquid Paraffin (Light) (500 ml)

Forceps Pointed

Forceps Blunt

Spirit Lamp

Wire Loop ( for bacterial culture) 1 mm internal diameter (10 Pcs per packet)

Wire Loop ( for bacterial culture) 2 mm internal diameter (10 Pcs per packet)

Wire Loop ( for bacterial culture) 4 mm internal diameter (10 Pcs per packet)

Straight Wire (Double wound suitable for stab inoculation) (10 Pcs per packet)

Teasing Needle (PCS)

Glass Rod (PCS)

Metal Loop Holder (SS Rod Holder with heat resistant in which any size nichrome wire can be inserted) (PCS)

Torunicate (PCS)

Sample storage Cryo Box (PCS)

Sharp Disposal Container (1 Ltr.)

Sodium Hypochloride 4-5% (5 Ltr)

Lysole (5 Ltr)

Cotton Roll (500 gm per roll)

Diamond Marker (GM)

Indikrom Papers (pH full range 1-14 ) (10 Boxes per pack)

Aluminium Foil (72 meter per pack)

Aluminium Cap for sealing of 30 ml Culture bottle (500 per pack)

Department of Microbiology Others

India Ink (25ml )

Mcfarland Standard Set (25ml each)

X V Factor disks (50 disc)

Hippurate Hydrolysis Broth (100ml)

Ninhydrate Solution (100ml)

X - Factor disk (50 disc)

Parafilm Roll (disc)

Lebolene (5 Ltr.)

Glass Marking Pencil (10 Per Pack)

Micro Tips with Filter (5ul to 100ul) (1000 Per Pack)

Micro Tips with Filter (200ul to 2000ul) (500 Per Pack)

Steam Indicator Tape (autoclave) (Pack)

Nichrome Loop 2mm internal diameter (10 x 5 x 1)

Anaerobic Gas Pack (05 Per Pack)

Lactophenol Cotton Blue (125ml )

Potassium tartrate (0.5ml x 5)

pH paper (range: 6-9) (10 x 1 )

pH paper (range: 4-12) (10 x 1 )

pH paper (range:2-10.5) (10 x 1 )

Moeller Lysine (100ml )

Moeller Arginine (100ml )

Moeller Ornithine (100ml )

Lugols Iodine Agar (100 gm )

Tryptic Soy Agar (100 gm)

Cystine Tryptone Agar (100 gm)

BBL - Hemoglobin Bovine, freeze Dried (100 gm)

Nichrome Loop 4mm internal diameter (10 x 5 x 1)

Close System - VITEK 2 compact 60 (Biomerieux)

Individual AST Panel for Gram Negative Organism(GN N280),Each Vitek 2 CLOSED SYTEM (20 Per Pack)

Individual AST Panel for Gram Positive Organism(GP P628),Each Vitek 2 CLOSED SYTEM (20 Per Pack)

Individual Identification Panel for aerobic Gram Negative Organism(GNID),Each Vitek 2 CLOSED SYTEM (20 Per Pack)

Individual Identification Panel for aerobic Gram Positive Organism(GPID),Each Vitek 2 CLOSED SYTEM (20 Per Pack)

Individual Identification Panel for anaerobic Gram Negative Organism(ANC),Each Vitek 2 CLOSED SYTEM (20 Per Pack)

Individual Identification Panel for anaerobic Gram Positive Organism(ANC),Each Vitek 2 CLOSED SYTEM (20 Per Pack)

Individual Identification Panel for fungus(YST),Each Vitek 2 CLOSED SYTEM (20 Per Pack)

Individual AST Panel for Gram Negative Organism(GN N281),Each Vitek 2- Closed system (20 Per Pack)

Individual AST Panel for Gram Positive Organism(ST03),Each Vitek 2- Closed system (20 Per Pack)

Individual Identification Panel for Nesseria and haemophilus,Each Vitek 2 CLOSED SYTEM (20 Per Pack)

Individual AST Panel for fungus(AST YS07),Each Vitek 2 CLOSED SYTEM (20 Per Pack)

Unsensitized tubes for Vitek2-Closed system (20 Per Pack)

Saline suspension for Vitek 2- Closed system (500ml)

Blood culture media aerobic for adult(BacT/Alert FA Plus),Each CLOSED SYSTEM (30 Per Pack)

Blood culture media aerobic for pediatric(BacT/Alert PF Plus),Each CLOSED SYSTEM (30 Per Pack)

Blood culture media anaerobic for adult(BacT/Alert FA Plus),Each CLOSED SYSTEM (30 Per Pack)

Blood culture media anaerobic for pediatric(BacT/Alert PF Plus),Each CLOSED SYSTEM

Blood culture media fungus- bottles per year, Fungus Can Be tested by all quoted bottles. In the same bottle bacteria and fungus can be tested.; Fungus Can Be tested by all quoted bottles. In the same bottle bacteria and fungus can be tested.(-),Consumable

Blood culture media mycobacterium spp(BacT/Alert MP (Plastic)),Each CLOSED SYSTEM (30 Per Pack)

State Virology Lab

Real time Primer Probe mix for detection of Influenza A viruses comprising of Influenza A + swine A + Swine H1 + Human Rnase P, each primer-probe mix provided in independent vial. Compatible with cobaz Z 480/Applied Biosystems 7500 Real Time PCR machine. Validated by CDC/WHO/FDA. Certified by CE-IVD/US-FDA. Sequences should be in accordance with the following guidelines of CDC : https://www.who.int/csr/resources/publications/swineflu/CDCRealtimeRTPCR_SwineH1Assay-2009_20090430.pdf?ua=1 Kit should have minimum 60% shelf life at the place of discharge of consignees. (Preferable pack size of 1000 reactions)

Pooled Influenza Positive controls for Real Time PCR; consisting of four different influenza viruses A/H1, A/H3, A/H1 pd09, Influenza B viruses and cultured human cells. Certified by CE-IVD/US-FDA. (Concentration range: 15000-20.000 copies/µl determined by qPCR ; 500ul/vial)

Influenza virus A/H3, RNA Control, Lyophilized RNA comprising of purified complete viral genome to amplify any of the sequence in the RNA required for molecular testing platform (qPCR), concentration should be atleast 10,000- 20,000 copies/μl, Non infectious, Resuspension vial to be provided within the kit with Molecular Biology Grade Water. Certified by CE-IVD/US-FDA. (Concentration range: 15000-20.000 copies/µl determined by qPCR ; 500ul/vial)

Primers and Probes for influenza-Type-B virus Forward Primer:TCCTCAAYTCACTCTTCGAGCG; HPLC Purified/22 mer, Reverse Primers- : CGGTGCTCTTGACCAAATTGG' ; HPLC Purified/21mer Probe: [6FAM] 5'CCAATTCGAGCAGCTGAAACTGCGGTG3'[MGBNFQ]; HPLC Purified/27 mer (custom)

Primers and Probes for influenza-Type-A [H3N2] virus AH3 Forward Primer:AAGCATTCCYAATGACAAACC ; HPLC Purified/21 mer, AH3 Reverse Primers- : ATTGCRCCRAATATGCCTCTAGT ; HPLC Purified/23mer Probe: [6FAM]/[VIC] 5'CAGGATCACATATGGGSCCTGTCCCAG3'[MGBNFQ]; HPLC Purified/27 mer

Primers and Probes for influenza-Type-B virus B HA BHA-188F Forward Primer:AGACCAGAGGGAAACTATGCCC ; HPLC Purified/22 mer, B HA BHA-270RReverse Primers- :TCCGGATGTAACAGGTCTGACTT ; HPLC Purified/23mer Type B Victoria Probe: [6FAM]/[VIC] 5'CAGACCAAAATGCACGGGGAAHATACC3'[MGBNFQ]; HPLC Purified/27 mer Type B Type B YamagataProbe: [6FAM]/[VIC] 5'CAGRCCAATGTGTGTGGGGAYCACACC3'[MGBNFQ]; HPLC Purified/27 mer

Primers and Probes for influenza-Type-A virus Forward Primer:GACCRATCCTGTCACCTCTGAC ; HPLC Purified/22 mer, Reverse Primers- : AGGGC TT TGGAC AA CG CTA ; HPLC Purified/21mer Probe: [6FAM] 5'TGCAGTCCTCGCTCACTGGGCACG 3'[MGBNFQ]; HPLC Purified/27 mer Reporter and Quencher dyes should be detectable and compatible with real time PCR machine cobasz480 and Quanta studio-7

Primers and Probes for Rnase P Rnase P forward :AGATTTGGACCTGCGAGCG ; HPLC Purified/21 mer, Rnase P Reverse - :GAGCGGCTGTCTCCACAAGT ; HPLC Purified/23mer Probe: [6FAM]/[VIC] 5-TTCTGACCTGAAGGCTCTGCGCG '3'[MGBNFQ]; HPLC Purified/27 mer Probe dyes both Reporter and Quencher dyes should be detectable and compatible with real time PCR machine cobasz480 (custom)

Influenza B viruses RNA Control including Victoria and Yamagata lineage , Lyophilized RNA comprising of purified complete viral genome to amplify any of the sequence in the RNA required for molecular testing platform (qPCR), concentration should be atleast 20,000 copies/μl, Non infectious, Resuspension vial to be provided within the kit with Molecular Biology Grade Water. Certified by CE-IVD/US-FDA. (Concentration range: 15000-20.000 copies/µl determined by qPCR ; 500ul/vial)

Real Time PCR Kit for qualitative detection of influenza B Viruses comprising of all necessary reagents (enzymes/enzyme mix, primers-probes, buffer, dNTPs, positive control, negative control, internal control and quantitation standards). Compatible with Cobas z480. CE-IVD/US-FDA certified. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack size of 64-96 Tests/pack)

Real Time PCR Kit for quantitative detection of influenza B Viruses comprising of all necessary reagents (enzymes/enzyme mix, primers-probes, buffer, dNTPs, positive control, negative control, internal control and quantitation standards). Compatible with Cobas z480. CE-IVD/US-FDA certified. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack size of 64-96 Tests/pack)

One-Step quantitative RT-PCR (qRT-PCR) Kit for detection and quantification of RNA using real-time detection instruments, comprising of following enzymes: MMLV Reverse Transcriptase (reduced RNase H activity and increased thermal stability) and Taq DNA polymerase (automatic ""hot start"" activity) in a single enzyme mix. Compatible with TaqMan probes. Should be able to detect as few as 10 copies of RNA template to 1 μg of RNA. Buffer in Reaction Mix should contain dNTPs and MgSO4. Additional Magnesium Sulfate vial should also be provided. Compatible with Cobas Z480 /Applied Biosystems 7500 Real time PCR machine. CE-IVD/US-FDA certified. WHO/CDC/FDA approved for diagnosis of Swine Flu, kit to be used as per the following guidelines https://www.who.int/csr/resources/publications/swineflu/CDCRealtimeRTPCR_SwineH1Assay0-2009_20090430.pdf?ua=1 Kit should have minimum 60% shelf life at the place of discharge of consignees. (Preferable pack size of 500-1000 reactions)

One Step RT-PCR kit for sensitive and end-point detection of RNA. Single tube format capable of performing both cDNA synthesis and PCR amplification, comprising of following enzymes: MMLV Reverse Transcriptase (reduced RNase H activity and increased thermal stability) and Taq DNA polymerase (automatic "hot start" activity) in a single enzyme mix. Should detect minimum 200 bp and maximum 4 kb product. Sensitive to detect 0.01 pg RNA. Buffer in Reaction Mix should contain 0.4 mM of each dNTP and 3.2 mM MgSO4. Additional Magnesium Sulfate vial should also be provided. Kit should have minimum 60% shelf life at the place of discharge of consignees. (Preferable pack size of 32-96 Tests/kit)

Multiplex Real time PCR kit for detection of Acute encephalitic syndrome - Varicella-zoster virus (VZV), Human herpes virus (HHV6, HHV7, HHV8), Herpes simplex virus 1/2 (HSV1/2), Cytomegalovirus (CMV), comprising of all necessary reagents (enzymes/enzyme mix, primers-probes, buffer, dNTPs, Positive control, internal control) to be included/ provided as one of the component of this kit. High sensitivity, specificity and reproducibility. No inter-assay variability. CE/US-FDA/IVD certified. Validated on clinical specimens such as CSF, blood and serum. Compatible with Cobas Z480 real-time PCR instrument. Interpretation software should be available if required. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack size of 32-96 Tests/kit)

Multiplex Real time PCR kit for detection of Acute encephalitic syndrome - Varicella-zoster virus (VZV), Herpes simplex virus 1/2 (HSV1/2), Cytomegalovirus (CMV), comprising of all necessary reagents (enzymes/enzyme mix, primers-probes, buffer, dNTPs, Positive control, internal control) to be included/ provided as one of the component of this kit. High sensitivity, specificity and reproducibility. No inter-assay variability. CE/US-FDA/IVD certified. Validated on clinical specimens such as CSF, blood and serum. Compatible with Cobas Z480 real-time PCR instrument. Interpretation software should be available if required. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay (Preferable pack size of 32-96 Tests/kit)

Multiplex Real-Time PCR Kit for detection of norovirus GI, norovirus GII, human astrovirus, rotavirus, human adenovirus and sapovirus and an internal control.The kit Can be used for extracted RNA from stool samples The kit primers/ probe and other component should follow Taqman chemistry, Integrated internal and positive controls should be provided, The reagents must be sufficient in quantity to enable testing of small number of samples at a time, Original kit inserts should be provided with the kit. High reproducibility. No inter-assay variability, Compatible with Cobas Z480 real-time PCR instrument. Interpretation software should be available if required. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. Desirable specifications: FDA/CE-IVD/WHO/CDC/NIV pune approved. (Preferable pack size of 32-96 Tests/kit)

Real- Time PCR Kit for quantitative detection of Hepatitis B Virus (HBV) DNA, comprising of all necessary reagents optimized for HBV DNA detection and quantitation (enzymes/enzyme mix, primers-probes, buffer, dNTPs, positive control, negative control, internal control and quantitation standards). Compatible with Cobas z480. Kit should be able to detect genotypes A–H. CE/US-FDA/IVD certified. Minimum 5 validated HBV quantitation standards are required. Kit should have high sensitive detection and broad linear range. Analytical sensitivity ≥95%, independent of the extraction system. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay.(Preferable pack of 96 Tests/kit)

Real- Time PCR Kit for quantitative detection of Hepatitis C Virus (HCV) RNA, comprising of all necessary reagents optimized for HCV RNA detection and quantitation (enzymes/enzyme mix, primers-probes, buffer, dNTPs, positive control, negative control, internal control and quantitation standards). Compatible with Cobas z480. CE-IVD/US-FDA certified. Kit should have high sensitive detection and broad linear range. Analytical sensitivity ≥95%, independent of the extraction system. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack of 96 Tests/kit)

Real- Time PCR Kit for quantitative detection of Herpes Simplex virus 1 (HSV-1) and herpes simplex virus 2 (HSV-2) specific DNA, comprising of all necessary reagents (enzymes/enzyme mix, primers-probes, buffer, dNTPs, positive control, negative control, internal control and quantitation standards). Compatible with cobas z480. CE-IVD/US-FDA certified. Sensitivity ≥95% independent of the extraction system. Detectable limit of minimum 10 RNA copies of HSV-1 and HSV-2. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack of 96 Tests/kit)

Conventional PCR Kit for qualitative detection of Herpes Simplex virus 1 (HSV-1) and Herpes simplex virus 2 (HSV-2) specific DNA in separate tubes, comprising of all necessary reagents (enzymes/enzyme mix, primers, buffer, dNTPs, positive control, negative control, internal control CE-IVD/US-FDA certified. Sensitivity ≥95% independent of the extraction system. Kit should have minimum 60% shelf life at the place of discharge of consignees. (Preferable pack of 100 reactions/ kit)

Real- Time PCR Kit for qualitative detection of Enteroviruses, comprising of all necessary reagents (enzymes/enzyme mix, primers-probes, buffer, dNTPs, positive control, negative control, internal control and quantitation standards). Compatible with Cobas z480 real time PCR instrument. CE-IVD/US-FDA certified. Information of target genes for enterovirus detection should be provided. Primer/probe used should cover amplification for all serotypes belonging to enterovirus group-A, B, C and D. Validated on clinical specimens such as CSF, stool etc. Sensitivity ≥95% independent of the extraction system. Detection limit should be minimum 10 copies/µl. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack of 60-96 Test/ kit)

Real- Time PCR Kit for quantitative detection of Enteroviruses, comprising of all necessary reagents (enzymes/enzyme mix, primers-probes, buffer, dNTPs, positive control, negative control, internal control and quantitation standards). Compatible with Cobas z480 real time PCR instrument. CE-IVD/US-FDA certified. Information of target genes for enterovirus detection should be provided. Primer/probe used should cover amplification for all serotypes belonging to enterovirus group-A, B, C and D. Validated on clinical specimens such as CSF, stool etc. Sensitivity ≥95% independent of the extraction system. Detection limit should be minimum 10 copies/µl. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack of 60-96 Test/ kit.)

Multiplex Real- Time PCR Kit for qualitative detection of Human Parainfluenza, human Metapneumovirus A/B (MPV A/B), human Coronavirus, human Adenovirus, human parechovirus, Human rhinovirus, influenza-A and Influenza-B, Respiratory Syncytial virus (RSV), comprising of all necessary reagents (enzymes/enzyme mix, primers-probes, buffer, dNTPs, positive control, negative control, internal control and quantitation standards). Compatible with Cobas z480. CE-IVD/US-FDA certified. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack of 32-96 Test/ kit.)

Multiplex Real- Time PCR kit for detection of Zika, Dengue, Chikungunya viruses, comprising of all necessary reagents (enzymes/enzyme mix:reverse transcriptase and Taq polymerase with hot start activity, primers-probes, Rnase inhibitor, buffer, dNTPs, positive control, negative control, internal control). Compatible with Cobas z480. CE-IVD/US-FDA certified. Singlplex/ Multiplex format. Primers and probes for each viral target genes and for human Ribonuclease P (RP) should follow taqman chemistry, IVD/FDA/CE/WHO approved. Compatible with cobas z480 real time PCR instrument. CE-IVD/US-FDA certified. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (preferable Pack of 500-1000 reactions)

Multiplex Real- Time PCR kit for detection of all the four Dengue serotypes (1-4), comprising of all necessary reagents (enzymes/enzyme mix:reverse transcriptase and Taq polymerase with hot start activity, primers-probes, Rnase inhibitor, buffer, dNTPs, positive control, negative control, internal control). Compatible with Cobas z480. CE-IVD/US-FDA certified. Multiplex format. Primers and probes for each viral target genes and for human Ribonuclease P (RP) should follow taqman chemistry, IVD/FDA/CE/WHO approved. Compatible with cobas z480 real time PCR instrument. CE-IVD/US-FDA certified. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (preferable Pack of 500-1000 reactions)

Real- Time PCR kit for detection of Enterovirus-71, comprising of all necessary reagents (enzymes/enzyme mix: Reverse-transcriptase mix, primers-probes, buffer, dNTPs, positive control, negative control, internal control). Compatible with Cobas z480 real time PCR instrument. CE-IVD/US-FDA certified. Validated with RNA from blood/ serum/stool/ vesicular fluid/throat swab/ rectal swab/CSF or cell culture samples OR directly for these samples. Sensitivity ≥95% independent of the extraction system. Kit should have minimum 60% shelf life at the place of discharge of consignees. (Preferable pack of 30-96 Test/ kit.)

Real time PCR Kit for detection of Human Papilloma Virus (HPV-16) and Human Papilloma virus 18 (HPV-18) specific DNA, Comprising of all necessary reagents (enzymes, primers-probes, buffer, dNTPs, positive control, negative control, internal control, Standards). Compatible with Cobas z480. CE-IVD/US-FDA certified. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack of 96 Tests/kit)

Real- time PCR Kit for detection of Zika virus, Comprising of all necessary reagents enzyme mix (enzymes/enzyme mix, primer-probe mix for Zika target and RNaseP in single/two-tube format, buffer, dNTPs, positive control, negative control, internal control). Compatible with Cobas z480/ Applied Biosystems 7500 real time PCR. Primers and probes for viral target gene and for human Ribonuclease P (RP), should follow taqman chemistry. WHO/CDC/FDA approved for diagnosis of Zika virus. Preferable pack-size of 500 reaction. Primers and Probe for each target gene is given as follows: Primers- Zika 1087: 5'CCGCTGCCCAACACAAG3' ;HPLC Purified/17 mer, Zika 1163c: 5'CCACTAACGTTCTTTTGCAGACAT3'; HPLC Purified/24 mer Probes- Zika 1108 FAM: [6FAM] 5'AGCCTACCTTGACAAGCAGTCAGACACTCAA3' [BHQ1]; HPLC Purified/31 mer (preferable Pack of 500 reactions)

Zika RNA Control, Lyophilized RNA comprising of purified complete viral genome to amplify any of the sequence in the RNA required for molecular testing platform (qPCR), concentration should be atleast 10,000-20,000 copies/μl, Non infectious, Resuspension vial to be provided within the kit with Molecular Biology Grade Water. FDA/ IVD Approved (Concentration range: 10,000-20,000 copies/µl determined by qPCR ; 500ul/vial)

Dengue RNA controls (Dengue virus 1, Dengue virus 2, Dengue virus 3, Dengue virus 4), Lyophilized RNA comprising of purified complete viral genome to amplify any of the sequence in the RNA required for molecular testing platform (qPCR), concentration should be atleast 10,000-20,000 copies/μl, Non infectious, Resuspension vial to be provided within the kit with Molecular Biology Grade Water. FDA/ IVD Approved (Concentration range: 10,000-20,000 copies/µl determined by qPCR ; 500ul/vial)

Chikungunya RNA control, Lyophilized RNA comprising of purified complete viral genome to amplify any of the sequence in the RNA required for molecular testing platform (qPCR), concentration should be atleast 10,000-20,000 copies/μl, Non infectious, Resuspension vial to be provided within the kit with Molecular Biology Grade Water. FDA/ IVD Approved (Concentration range: 10,000-20,000 copies/µl determined by qPCR ; 500ul/vial)

Japanese Encephalitis RNA Control, Lyophilized RNA comprising of purified complete viral genome to amplify any of the sequence in the RNA required for molecular testing platform (qPCR), concentration should be atleast 10,000-20,000 copies/μl, Non infectious, Resuspension vial to be provided within the kit with Molecular Biology Grade Water. FDA/ IVD Approved (Concentration range: 10,000-20,000 copies/µl determined by qPCR ; 500ul/vial)

Rabies RNA control, Lyophilized RNA Resuspendable up to 500 μl, Purified complete microbial genome, Any sequence can be amplified, Can be used in any molecular testing platform, Concentration range: 10,000-20,000 copies/μl determined by qPCR, Non infectious, A resuspension vial maybe provided within the kit with Molecular Biology Grade Water (Concentration range: 10,000-20,000 copies/µl determined by qPCR ; 500ul/vial)

West Nile RNA Control, Lyophilized RNA Resuspendable up to 500 μl, Purified complete microbial genome, Any sequence can be amplified, Can be used in any molecular testing platform, Concentration range: 10,000-20,000 copies/μl determined by qPCR, Non infectious, A resuspension vial maybe provided within the kit with Molecular Biology Grade Water (Concentration range: 10,000-20,000 copies/µl determined by qPCR ; 500ul/vial)

Japanese Encephalitis virus (JEV) real time PCR kit for quantitation. Desirable specifications: FDA/CE-IVD/WHO/CDC/NIV pune approved, Compatible with Cobas Z480 real-time PCR instrument. Approved Interpretation software should be available if required. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack of 96 Tests/kit)

Molecular - Encephalitis panel – Duplex PCR kit for detection of West Nile Virus (WNV), Japanese Encephalitis virus (JEV) with positive control,negative control and internal control, Real- time PCR Kit Compatible with cobas z480. Desirable specifications: FDA/CE-IVD/WHO/CDC/NIV pune approved. Colour compensation kit should be provided, if required for running the assay.Kit should have minimum 60% shelf life at the place of discharge of consignees. (Preferable pack of 60-96 Tests/kit)

Cytomegalovirus real time PCR kit, Desirable specifications: FDA/CE-IVD/WHO/CDC/NIV pune approved, Compatible with Cobas Z480 real-time PCR instrument. Interpretation software should be available if required. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack of 96 Tests/kit)

Real time RT-PCR kit for Coxsackie virus,kit can be used for extracted RNA from blood/ serum/ cell culture samples kit Should be preferably able to identify common serotypes of Type A and Type B Coxsackie viruses. Compatible with Cobas Z480 real-time PCR instrument. Interpretation software should be available if required. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. Desirable specifications: FDA/CE-IVD/WHO/CDC/NIV pune approved (Preferable pack of 32-96 Tests/kit)

Real Time PCR kit for Rabies virus, The kit primers/ probe and other component should follow Taqman chemistry, Integrated internal and positive controls should be provided, can detect low viral load, The reagents must be sufficient in quantity to enable testing of small number of samples at a time, Original kit inserts should be provided with the kit. High reproducibility. No inter-assay variability, Desirable specifications: FDA/CE-IVD/WHO/CDC/NIV pune approved (Preferable pack of 32-96 Tests/kit)

Coxsackie Virus A16 real time PCR kit, The kit Can be used either for extracted RNA from blood/ serum/stool/ vesicular fluid/throat swab/ rectal swab/CSF or cell culture samples OR it can be used directly for these samplesThe kit primers/ probe and other component should follow Taqman chemistry, Integrated internal and positive controls should be provided, The reagents must be sufficient in quantity to enable testing of small number of samples at a time, Original kit inserts should be provided with the kit. High reproducibility. No inter-assay variability, Desirable specifications: FDA/CE-IVD/WHO/CDC/NIV pune approved. ApprovedKit should have minimum 60% shelf life at the place of discharge of consignees. (Preferable pack of 32-96 Tests/kit)

Parvovirus B19 real time PCR kit. The kit can be used either for extracted DNAof human parvovirus B19 in serum or plasma. The kit must comprise of all necessary reagents (enzymes/enzyme mix:reverse transcriptase and Taq polymerase with hot start activity, primers-probes, Rnase inhibitor, buffer, dNTPs, positive control, negative control, internal control). Compatible with Cobas z480. The reagents must be sufficient in quantity to enable testing of small number of samples at a time, Original kit inserts should be provided with the kit. High reproducibility. No inter-assay variability, Desirable specifications: FDA/CE-IVD/WHO/CDC/NIV pune approved. ApprovedKit should have minimum 60% shelf life at the place of discharge of consignees.(Preferable pack of 32-96 Tests/kit)

Real- Time PCR Kit for quantitative detection of Cytomegalovirus (CMV) DNA, comprising of all necessary reagents optimized for CMV DNA detection and quantitation (enzymes/enzyme mix, primers-probes, buffer, dNTPs, positive control, negative control, internal control and quantitation standards). Compatible with Cobas z480. Kit should be able to detect genotypes A–H. CE/US-FDA/IVD certified. Minimum 5 validated CMV quantitation standards are required. Kit should have high sensitive detection and broad linear range. Analytical sensitivity ≥95%, independent of the extraction system. Kit should have minimum 60% shelf life at the place of discharge of consignees. Colour compensation kit should be provided, if required for running the assay. (Preferable pack of 96 test/kit)

Real- Time PCR kit for qualitative detection of SARS-CoV-2 virus comprising of all necessary reagents. Primers and probes for E gene, N gene, S gene, RDRP, Orf 1ab, and target genes for human Ribonuclease P (RNP) should follow taqman chemistry. Compatible with Cobas z 480, Applied Biosystems QS 7 Flex and BioRad CFX96. Singleplex/ Multiplex format. IVD/FDA/CE/WHO approved. Colour compensation kit should be provided, if required for running the assay. (Preferable pack size of 500-1000 reactions)

Zika virus IgM ELISA, Approved by FDA/ IVD/CDC/WHO/CE for serology based diagnosis of Zika virus from human serum, plasma. (preferable Pack of 96 test/kit)

Zika virus IgG ELISA, Approved by FDA/ IVD/CDC/WHO/CE for serology based diagnosis of Zika virus from human serum, plasma. (preferable Pack of 96 test/kit)

Dengue virus IgM ELISA kit from human serum and plasma, Approved by FDA/ IVD/CDC/WHO/CE, Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Dengue virus IgG ELISA kit from human serum and plasma, Approved by FDA/ IVD/CDC/WHO/CE, Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Dengue virus NS1 ELISA kit from human serum and plasma, Approved by FDA/ IVD/CDC/WHO/CE, Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Chikungunya IgM ELISA, Approved by FDA/ IVD/CDC/WHO/CE, Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Chikungunya IgG ELISA, Approved by FDA/ IVD/CDC/WHO/CE, Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Dengue Duo (Dengue NS1 Ag + IgG + IgM) Rapid card test, from serum and plasma, Approved by FDA/ IVD/CDC/WHO/CE , Expiry of the kit should not be less than 1 year (preferable Pack of 50-100 test/kit)

Hepatitis A IgM ELISA capable of detecting IgM anti HAV antibodies and should be compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (preferable Pack of 96 test/kit)

Hepatitis B (HBsAg) Detection Rapid Card Test for qualitative detection of Hepatitis B virus surface antigen in serum and Plasma. FDA/ IVD/CDC/WHO Approved (preferably 50 card/pack)

Hepatitis C (HCV) Rapid Card Test for qualitative detection Hepatitis C virus antibody in serum and plasma. FDA/ IVD/CDC/WHO Approved (preferably 50 card/pack)

Anti HBc-IgM ELISA capable of detecting IgM antibodies to Hepatitis B virus Core antigen, compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (preferable Pack of 96 test/kit)

Anti HBc (Total Ab ELISA), capable of detecting Total antibodies to Hepatitis B virus Core antigen, compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (preferable Pack of 96 test/kit)

Anti-HBs ELISA (Quantitative), capable of quantitative determination of antibodies to hepatitis B virus surface antigen (anti-HBs) in human serum or plasma for clinical purposes and assessing antibody response levels to HBsAg-vaccine. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (preferable Pack of 96 test/kit)

Hepatitis B (HBsAg ELISA) Kit. Compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (preferable Pack of 96 test/kit)

Hepatitis B (HBeAg ELISA) kit. Compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (preferable Pack of 96 test/kit)

Hepatitis B (Anti-HBeAg ELISA) kit. Compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (preferable Pack of 96 test/kit)

Anti HBV Ab ELISA Kit. Compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (preferable Pack of 96 test/kit)

Hepatitis C (Total Ab ELISA) kit. Compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (preferable Pack of 96 test/kit)

Hepatitis D (Anti-HDV ELISA) kit. Compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (preferable Pack of 96 test/kit)

Hepatitis E IgM ELISA kit. Compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (preferable Pack of 96 test/kit)

Japanese Encephalitis IgM ELISA kit. (preferable Pack of 96 test/kit)

Rotavirus Antigen ELISA Kit (Human) (preferable Pack of 96 test/kit)

Adenovirus antigen ELISA kit (Human) Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Mumps Virus IgM ELISA (preferable Pack of 96 test/kit)

Parvo virus B19 IgM ELISA (preferable Pack of 96 test/kit)

Parvo virus B19 IgG ELISA (preferable Pack of 96 test/kit)

West Nile virus IgM capture ELISA kit (96 wells), The kit should be compatible for human Serum /CSF specimens for detection of Ig M antibodies to West nile virus, Desirable specifications: IVD/FDA/CE/WHO approved .The kit should have a shelf-life of at least 6 months when stored at temperature of 2 - 8 ºC The kits must be of very high sensitivity 95%, specificity 90-95% as claimed by the manufacturer in kit insert (preferable Pack of 96 test/kit)

West Nile virus IgG capture ELISA kit (96 wells), The ELISA kit should be designed for qualitative detection of West Nile virus IgG antibody in human serum..Desirable specifications: IVD/FDA/CE/WHO approved .The kit should have a shelf-life of at least 6 months when stored at temperature of 2 - 8 ºC (preferable Pack of 96 test/kit)

HSV1 & HSV 2 IgM ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

HSV1 & HSV 2 IgG ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

HSV1 & HSV 2 Antibody ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells, should be separate/ detachable to enable testing of small number of samples, reagents and controls must be in sufficient quantity to enable testing of small number of samples at a time. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. (preferable Pack of 96 test/kit)

Toxoplasma IgG ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Toxoplasma IgM ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Rubella IgM ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Rubella IgG ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Cytomegalo Virus IgM ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Cytomegalo Virus IgG ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Measles IgM ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Measles IgG ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

TORCH Panel Rapid Card Test, for qualitative detection and differentiation of antibodies (IgM & IgG) to TORCH Panel in human serum/plasma or whole blood. FDA/ IVD/CDC/WHO Approved. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Mumps IgG ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Vericella Zooster Virus IgM ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 96 test/kit)

Epstein - Barr Virus, Viral Capsid Antigen (VCA) IgM ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (Preferable pack of 96 test/kit)

Scrub Typhus IgM ELISA in 96 wells format (12 columns X 8 rows) comprising of 12 strips, each consisting of 8 wells. Preferably one year expiry but not less than six months, Sensitivity of >95% and a specificity of >95%. Minimum 60% shelf life left at the time of delivery. CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (Preferable pack of 96 test/kit)

Scrub Typhus Rapid Card Test, for qualitative detection and differentiation of antibodies (IgM & IgG) to Scrub Typhus in human serum/plasma or whole blood. FDA/ IVD/CDC/WHO Approved. Expiry of the kit should not be less than 1 year (Preferable pack of 50-100 cards/kit)

Hepatitis D IgM ELISA capable of detecting IgM anti HDV antibodies and should be compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (Preferable pack of 96 test/kit)

Hepatitis D Virus Antigen ELISA Kit capable of detecting HDV antigen and should be compatible with plasma and serum both. IVD/FDA/CE/WHO approved. All the assay components provided must be in sufficient quantity to enable testing of small number of samples at a time. Kit size should be 96 tests/kit (in strips of 12x8 wells) such that individual strips can be used for testing. (Preferable pack of 96 test/kit)

Hepatitis A IgM (HAV) Rapid Card Test for qualitative detection Hepatitis A virus IgM antibody in serum and plasma. FDA/ IVD/CDC/WHO Approved (Preferable pack of 50 cards/kit)

Hepatitis E IgM (HEV) Rapid Card Test for qualitative detection Hepatitis E virus IgM antibody in serum and plasma. FDA/ IVD/CDC/WHO Approved (Preferable pack of 50 cards/kit)

Anti-Nuclear Antibody IgG ELISA, Approved by FDA/ IVD/CDC/WHO/CE (Preferable pack of 96 test/kit)

Direct fluorescent antibody (DFA) kit for HSV-1/2 antigen, compatible with FITC filter, CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 50-96 Tests/kit)

Direct fluorescent antibody (DFA) kit for VZV antigen, compatible with FITC filter, CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 50-96 Tests/kit)

Direct fluorescent antibody (DFA) kit for respiratory virus Panel CE-IVD/US-FDA certified. Expiry of the kit should not be less than 1 year (preferable Pack of 50-96 Tests/kit)

Viral Total Nucleic acid Extraction Kit for purification of viral RNA and DNA from plasma, serum, CSF, cell-free body fluids and culture supernatants with fast spin-column procedures. Kit should contain carrier RNA to enhance binding of viral RNA to column and thus improve yield. P:roteinase K should also be provided. Elution volume should be atleast 50-60 μl. Hands-on preparation time should not be more than 30-40 minutes. CE-IVD/US-FDA certified. Preferable pack size of 100-500 reaction per kit. (Preferable pack size of 100-500 reaction/kit)

Viral RNA Extraction kit for purification of viral RNA from plasma, serum, lymphocytes, cultured cells, cell-free body fluids and culture supernatants with fast spin-column procedures. Kit should contain carrier RNA to enhance binding of viral RNA to column and thus improve yield. Elution volume should be atleast 50-60 μl. Hands-on preparation time should not be more than 30-40 minutes. CE-IVD/US-FDA certified. Preferable pack size of 250 rx. (Preferable pack size of 250 reaction/kit)

Viral DNA Extraction kit for purification of viral DNA from tissues, swabs, CSF, blood, body fluids, or washed cells from urine, silica-membrane-based, enzymatic lysis of tissues. Yield should be more than 1 µg DNA, Elution volume should be atleast 50-60 μl. Hands-on preparation time should not be more than 30-40 minutes. CE-IVD/US-FDA certified. Preferable pack size of 250 rx. (Preferable pack size of 250 reaction/kit)

Gel extraction kit, for cleanup of upto 10μg DNA (100bp to 10kb) with 95% recovery of DNA. Gel loading dye should be provided for convenient sample analysis. Preferable pack of 250. pH indicator dye should be provided. (Preferable pack size of 50 reaction/kit)

PCR Product Purification kit, for accurate and consistent One tube, One step PCR cleanup. Turnaround time should not be more than 10 minutes. Recovery should be atleast 95% regardless of amplicon length, It should be capable of purifying PCR reaction volumes from 10-100μl. (Preferable pack size of 50 reaction/kit)

PCR product purification columns, Should be accurate and consistent Should have turnaround time of 5-10 minutes, Should be One-tube, one-step PCR cleanup method to minimize errors, With 95-100% recovery of PCR product regardless of amplicon length, Can purify PCR reaction volumes from 5 - 100 μl,The reagents must be sufficient in quantity to enable performing of small number of samples at a time. Original kit inserts should be provided with the kit. (Preferable pack size of 50-100 reaction)

miRNA Isolation Kit, for isolating total RNA, miRNA, siRNA, shRNA, snRNA from tissue/cells/serum/plasma in 30 minutes, manual, glass fiber filter based method, yield of total RNA ranging in size from Kbs to 10-mers, kit should consist of all necessary reagents like filter Cartridges, lysis/binding buffer, wash solutions, collection tubes, Acid-Phenol:Chloroform, Gel Loading Buffer, Elution buffer, (Preferable pack size of 40-50 reaction)

miRNA Arrays, for microarray, 5-10 samples, should detect all mature miRNA sequences available in miRBase Release 20 (human, mouse, rat, or every miRNA for all species), should be able to analyze human, mouse, rat, etc using the same array (single array should be compatible for multiple organisms), array should be Photolithography based, total miRNA probes should be > 30,000, among which human mature miRNA should be >2500 and human pre mi-RNA should be > 2000, input RNA should not be more than 150 ng, microarray analysis can be easily done on Expression Console and Transcriptome Analysis Console Softwares. (Preferable pack size of 5-10 samples)

miRNA Arrays, for microarray, 20-30 samples, should detect all mature miRNA sequences available in miRBase Release 20 (human, mouse, rat, or every miRNA for all species), should be able to analyze human, mouse, rat, etc using the same array (single array should be compatible for multiple organisms), array should be Photolithography based, total miRNA probes should be > 30,000, among which human mature miRNA should be >2500 and human pre mi-RNA should be > 2000, input RNA should not be more than 150 ng, microarray analysis can be easily done on Expression Console and Transcriptome Analysis Console Softwares. (Preferable pack size of 20-30 samples)

Hybridization Control kit, for microarray, for 30-50 rxns, comprising of all necessary reagents (20X Hybridization Control Stock composed of pre-mixed biotin-labeled bioB, bioC, bioD and cre, in staggered concentrations, Control Oligo B2) required for microarray experiment. (Preferable pack size of 30-50 rxn/Kit)

Hybridization, Wash and Stain Kit, for microarray, for 30-50 rxns, comprising of all necessary reagents (Pre-Hybridization Module, Hybridization Mix, DMSO, Nuclease-free water, Stain Module, Array Holding Buffer, Wash Buffers etc) required for microarray experiment. (Preferable pack size of 30-50 rxn/Kit)

Biotin RNA Labeling Kit, for microarray, for 30-50 rxns, comprising of all necessary reagents (RNA spike control oligos), it should work with various samples, High Sensitivity, Specificity and Reproducibility (Preferable pack size of 30-50 rxn/Kit)

miRNA microarray services using human serum samples, should provide all services from sample collection (from State Virology lab, GMC Bhopal), sample despatch to respective microarray lab, miRNA isolation, quality check of isolated miRNA, miRNA profiling by microarray, should detect all mature miRNA sequences available in miRBase Release 20 (human, mouse, rat, or every miRNA for all species), should be able to analyze human, mouse, rat, etc using the same array (single array should be compatible for multiple organisms), array should be Photolithography based, total miRNA probes should be > 30,000, among which human mature miRNA should be >2500 and human pre mi-RNA should be > 2000, input RNA should not be more than 150 ng, should provide filtered output data at State Virology lab, GMC Bhopal, microarray analysis can be easily done on Expression Console and Transcriptome Analysis Console Softwares.(custom)

Conventional PCR Product sequencing services of purified PCR product on Conventional capillary sequencer(custom)

Conventional PCR Product sequencing services of unpurified PCR product on Conventional capillary sequencer (custom)

For whole genome sequencing services of RNA/DNAviruses of genome size from 2kb-50kb present in biological samples, cell culture samples, purified culture samples on nanoplatform Next Generation Sequencer , should provide all services from sample collection (from State Virology lab, GMC Bhopal), sample despatch to respective sequencing lab, and involving Quality check on agarose gel, quality check on Qubit, poly-a addition if necessary, library prepration for nanopore, nanopore barcoding, Nanopore Sequencing for longer reads, should provide output data to State Virology lab, GMC Bhopal, Analysis and interpretation and finally the publication support for the generated data.(custom)

Sybr Green real time polymerase chain reaction kit comprising of all necessary reagents (Taq DNA Polymerase with hotstart activity, dNTPs with dUTP/dTTP blend, heat-labile UDG, ROX passive reference dye, and buffer containing SYBR Green dye). Compatible with cobas z480 real time PCR instrument. Preferable pack of 500 reactions. (Preferable pack size of 100-500 reaction/kit)

Taq DNA polymerase kit containing Taq DNA Polymerase with hot start activity that can generate PCR products up to 10 kb, PCR Buffer with Magnessium (Mg+), and required dNTP mix, 50mM Magnesium chloride, input human genomic DNA samples as few as 10 ng can be amplified, yield of 5 ng-40 ng of about 500-1000 base pair. (Preferable pack size of 100- 300 reaction/kit)

c-DNA first strand synthesis super mix comprising of all the reagents (Rnase inhibitor, random primers, buffers and dNTP) for reverse transcription from purfied poly(A)+ or total RNA, should detect 100 bp to >12 kb RNA targets, starting material from .1 pg to 5 μg of total RNA. (Preferable pack size of 50 reaction/kit)

Hot start Taq DNA polymerase, along with optimized PCR buffer, 25 mM MgCl2 Solution and GC-RICH Solution to handle a wide range of templates, activity of 5 U/μl, recombinant Taq DNA Polymerase should remain inactive at temperatures below +75°C and gets activated by 2 to 4 minute heat activation step at +95 °C, preferable pack of 100 units.( Preferable pack size of 100-250 unit/kit)

Taq DNA polymerase without hotstart activity, along with PCR Buffer MgCl 10x concentrated, MgCl Stock Solution, PCR Buffer without MgCl, concentration of 5 U/μl, highly processive with 5′→3′ DNA polymerase activity, lacking 3′→5′ exonuclease activity, optimally activity at +75°C and pH 9, amplify the DNA fragments up to 3 kb in PCR, Preferable pack of 100 units. (Preferable pack size of 100-250 unit/kit)

Poly(A) Tailing Kit, for 25-50 reactions, should be capable adding a poly(A) tail of at least 100-150 nucleotides in length to the 3' termini of RNA (Preferable pack of 25-50 reactions /kit)

Colour change lab-top cooler for 0.2 ml PCR tubes, 96 well 1 item

Recombinant Ribonuclease (Rnase) inhibitor (Rnase out), 40U/ul, for isolation of intact RNA transcripts using T3, T7, and SP6 RNA Polymerases at 20–40 units/10 μL of reaction mixture (Preferable pack size of 2500-5000unit/tube)

One-step RT-qPCR Master Mix containing unique reverse transcriptase enzyme solution and the aptamer-mediated hot start AptaTaq Fast DNA Polymerase of 100x-200x conc, dNTPs, and a reaction mix in range of concentration 2x-5x for multiplex qPCR especially suited for the fast and efficient detection of virus parameters in human samples. (Preferable pack size of 5unit-50 unit unit/ul/kit)

Hot start reaction mix for probe-based real-time PCR compatible for use with cobasz480 instruments. It must contain the Taq DNA Polymerase for hot start PCR, with high specificity and sensitivity of PCR and minimizes the formation of nonspecific amplification product. It should come with PCR grade water. (Preferable pack size of 500-5000 reactions)

Uracil-DNA Glycosylase, Preferable pack of 100-200 units. (Preferable pack of 100-200 units)

RNA quantification Kit, High sensitivity for flurometer, should detect RNA sample concentrations between 250 pg/µL and 100 ng/µL, containing concentrated assay reagent, dilution buffer, and pre-diluted RNA standards, acceptable range of Sample volume should be between 1 µL-20 µL. (Preferable pack size of 100 reactions)

RNA quantification Kit, Broad Range, for flurometer, should detect RNA sample concentrations from 1 ng/µL to 1 µg/µL, containing concentrated assay reagent, dilution buffer, and pre-diluted RNA standards, assay range from 20–1,000 ng. (Preferable pack size of 100 reactions)

DNA quantification Kit, High sensitivity, for flurometer, should quantifiy DNA concentration with high confidence in range 1 ng/mL to 500 ng/mL, extended ranges should be 0.5 ng/mL to 1 ng/mL and 500 ng/mL to 600 ng/mL, can be used for quantitation of PCR products, viral DNA, and samples for subcloning, capable of quantifying DNA accurately even in the presence of RNA, salts, solvents, proteins, and free nucleotides. (Preferable pack size of 100 reactions)

DNA quantification Kit, Broad Range, for flurometer, should quantifiy DNA concentration with high confidence in range 0.01 µg/mL to 5 µg/mL, extended ranges should be 5 µg/mL to 10 µg/mL, can be used for quantitation of genomic and miniprep DNA samples, capable of quantifying DNA accurately even in the presence of RNA, salts, solvents, proteins, and free nucleotides. (Preferable pack size of 100 reactions)

Assay tubes for fluorimeter, 500µL volume, thin-walled, polypropylene tubes, compatible for use with the Qubit Fluorometer. Preferable pack size of 250-500 tubes/pack (250-500 tubes/pack)

Primers for Real Time PCR, HPLC purified, Approx. 25 bp, 100nm scale, Sequence will be provided at the time of placing order, Sequence to be confirmed before delivery. (custom)

Probes for Real Time PCR, HPLC purified, Approx 25bp, Taqman chemistry, labelled at 5’end with reporter molecule (FAM/VIC/JOE/ROX/Cy5/TEXAS RED etc) and with quencher (BHQ/NFQ) at 3’end, compatible with the Real Time PCR primers, Probe sequence along with specific reporter and quencher dye will be provided at the time of placing order, rates may be quoted for each quencher and Reporter dye separately, Probe sequence, reporter and quencher to be confirmed before delivery. (custom)

Primers for conventional PCR, HPLC purified, Approx. 25bp, 100nm scale, Sequence will be provided at the time of placing order, Sequence to be confirmed before delivery (custom)

Primers for PCR, Desalted, Size - approx. 25 nucleotides, Synthesis Scale - 100 nm, Sequence will be provided at the time of placing order, Sequence to be confirmed before delivery (custom)

DNAse/ RNase away Solution. Preferable 500ml per pack (500ml per pack)

Agarose powder (molecular grade) molecular grade)for separation of nucleic acid range50bp to50 Kb. (preferable pack of 500gm/pack)

SyBR safe DNA gel stain. Preferable pack of 300-500ul/vial (300-500ul/vial)

TAE buffer (Tris-acetate-EDTA) (50 X) (500ml)

TBE buffer 50x (molecular grade) (500ml)

DNA ladder-1000 bp, ready to use, Composed of chromatography-purified individual DNA fragments) for sizing and approximate quantification of doublestranded DNA on agarose gel, 0.1μg/μl. Preferable pack size of 50 μg-250 μg per vial (50 μg-250 μg per via)

DNA ladder-100 bp, ready to use, Composed of chromatography-purified individual DNA fragments) for sizing and approximate quantification of doublestranded DNA on agarose gel, 0.1μg/μl. Preferable pack size of 50 μg-250 μg per vial

DNA ladder-50 bp, ready to use, Composed of chromatography-purified individual DNA fragments) for sizing and approximate quantification of doublestranded DNA on agarose gel, 0.1μg/μl. Preferable pack size of 50 μg-250 μg per vial

Gel loading dye (6X) at volume of 0.5ml/vial 5-10 vial per pack (0.5ml/vial)

10X PBS, Molecular grade. preferable pack size in range of 500-1000ml/pack (preferable pack size of 500-1000ml/pack)

DNAse I (Rnase-free). preferable in pack size in range from 1000unit-5000unit/pack

RNAse H, preferable in pack size in range from 50unit-250 unit/pack (preferable in pack size from 50unit-250 unit/pack)

RNase A., preferable in pack size in range from 500ul-1 ml/vial (pack of 1 ml)

Ethidium bromide solution, ready to use, 1 mg/ml 1 vial (10 ml)

EDTA (7.8 pH), Molecular grade. preferable in pack size in range from 250-500gm/pack (preferable in pack size from 250-500gm/pack)

Tris base, preferable in pack size in range from 250-500gm/pack (preferable in pack size from 250-500gm/pack)

DTT (1,4-Dithiothreitol), preferable in pack size in range from 5-25gm/pack (preferable in pack size from 5-25gm/pack)

Nuclease free water (molecular grade, DEPC treated) (500 ml)

Random primer mix. preferable in pack size in range from100-200ul/pack preferable in pack size from 100ul/pack

Random Hexamer. preferable in pack size in range from 50uM-250uM/pack preferable in pack size from 50uM-250uM/pack

dNTPs 25mM each (100mM mix)

dNTPs 10mM each (40mM mix)

Taq DNA polymerase at a concentartion of 5000-10000 units/ml with buffer containing 10X reaction buffer containng non-ioninc detergents and salts such as ammonium sulphate and Tris-HCl , potassium chloride with pH in range of 8-9 at 25 degree centigrade and supplemented with 50mM-100mM Magnessium Sulphate for reaction optimization preferable in pack size from 100unit-500unit/pack

Universal Color Compensation Kit (covering excitation and emission wavelength in range from 465nm-700 nm) compatible with Cobasz480 1 item

Ethanol, for molecular Biology work 500 ml

Boric acid, for molecular Biology work 500 ml

Glacial Acetic acid, for Molecular Biology work 500 ml

Isoamyl alcohol, for Molecular Biology work 500 ml

Isopropanol, for Molecular Biology work 500 ml

Acetone, for Molecular Biology work 500 ml

Glycerin, for Molecular Biology work 500 ml

Glycerol, for Molecular Biology work 500 ml

Ficoll, for Molecular Biology work 500 g

Sodium acetate, for Molecular Biology work 500 g

Sodium azide, for Molecular Biology work 100 g

Phenol, for Molecular Biology work 500 ml

Potassium Iodide 100gm

Phenol red, for Molecular Biology work 50gm

Chloroform, for Molecular Biology work 500 ml

Phenol:Chloroform:Isoamyl Alcohol 25:24:1 solution, Saturated with 10mM Tris, pH 8.0, 1mM EDTA 500 ml

Sodium chloride, for Molecular Biology work 500 g

Potassium chloride, for Molecular Biology work 500 g

Calcium chloride anhydrous, for Molecular Biology work 500 g

Magnesium chloride, for Molecular Biology work 500 g

Disodium hydrogen phosphate anhydrous (Na2HPO4) 500 g

Potassium dihydrogen phosphate anhydrous (KH2PO4) 500 g

Potassium permanganate 500g

Diethyl barbituric acid, for Molecular Biology work 500 g

Merthiolate, for Molecular Biology work 500 g

D-Glucose, for Molecular Biology work 500 g

Phenol Chloroform mixture, Molecular Grade 500 ml

Sodium Dodecyl Sulfate (SDS) 500 g

Ether, Molecular Grade 500 ml

Formaldehyde Solution (37%), Molecular Grade 500 ml

Conc. Hydrochloric acid (37%) 500 ml

Conc. Sulphuric acid (99.9%) 500 ml

Sodium hyphoclorite solution (5%) 5 litre

Tween 20 (Molecular Grade) 500 ml

Tween 80 (Molecular Grade) 500 ml

Liquid ammonia 500 ml

Sodium bicarbonate, Cell culture grade 500 g

Sodium Dihydrogen orthophosphate 500 g

Disodium Hydrogen phosphate 500 gm

DMSO, Cell culture grade 100 ml

Sodium hydroxide pellets, Molecular Grade 500 g

Poly ethylene glycol (Molecular Grade) 500 g

Bovine Serum albumin (Molecular Grade) 500 g

Sodium Citrate (Dihydrate) Molecular Grade 500 g

Citric acid for molecular biology work 500 g

Magnesium sulphate (Molecular Grade) 500 g

Gelatin 500 g

Calcium carbonate (Molecular Grade) 500 g

Methyl Cellulose (Cell Culture Grade) 500 g

Standard pH Buffer capsules (4.0 pH) 1 item

Standard pH Buffer capsules (7.0 pH) 1 item

Standard pH Buffer capsules (9.0 pH) 1 item

pH paper (range: 6-9) 100 strips/pack

pH paper (range: 4-12) 100 strips/pack

pH paper (range:2-10.5) 200 no./pack

TEMED for molecular biolgy work 25-100ml/pack

B-mercaptoethanol also known as 2-Mercaptoethanol (Molecular Grade) 100ml

Coomassie brilliant blue 500 g

Potassium Dichromate 500 g

Butanol, Molecular grade 500 ml

Surface senitizer (Germitol or equivalent) 1 Ltrl

Methanol, Molecular Grade 500 ml

Acrylamide (Molecular Grade), DNAse, Rnase, Protease free, to be used for electropheris in prepration of polyacrylamide gels 500 g

Acrylamide Bis-acrylamide 29:1, 30% ready to use Solution 500 ml

N,N′-Methylenebis(acrylamide), also known by name Bis-acrylamide, powder form for molecular biology work 100 g

Ammonium persulfate (APS) for molecular biology work to be used in prepration of PAGE 100 ml

Xylene Cyanol, for Molecular Biology work, to be used as tracker dye in DNA sequencing and electrophoresis, water soluble if supplied in powder form, prefearable pack size of 10 g in a single bottle, or concentration of 1mg/ml if supplied in solution. Preferable pack size of 10-100gm pack

Bromophenol blue, Tracking dye for nucleic acid or protein electrophoresis, pH indicator (pH 3.0 (yellow) - 4.6 (blue), powdered or solution, water soluble if supplied in powder form with appearance of Bluish-violet colur on making solution. Preferable pack size of 100gm-500gm per pack or 100ml-500ml/pack

Coomassie brilliant blue R-250 ready to use solution for molecular biology work Preferable pack size of 100ml

Trizol reagent, ready to use mixture of phenol and guanidine isothiocyanate, for isolation of RNA, DNA and protein from a variety of biological samples, should workwith tissue from 50–100 mg to more than 1 gm and cells with 106-107 in quantities, should support the completion of total RNA isolation in 1 hour, should be free of protein and DNA contamination, should be supplied for 100 prepration reactions and 100 ml pack size. Preferable pack size of 100ml

Diethyl Pyrocarbonate solution (DEPC), a nuclease inhibitor particularly against ribonucleases (RNases), for Molecular Biology work, should be provided in solution form in brown bottle, Preferable pack size of 100 ml. Preferable pack size of 100ml

Biological indicator for steam sterilization, to verify the sterility of instruments, vials, glassware, and other products in less time, colour should change after sterilization, Indicators should be supplied with a spore population of Geobacillus stearothermophilus (minimum 105 spores), Preferable pack size of 100 counts should be provided. Preferable pack size of 50-100 count/pack

Penicillin–Streptomycin Solution (with 10,000 units penicillin and 10ug/ml streptomycin) Preferable pack size of 100ml

Fungizone, cell culture grade (Preferable pack size of 500 gm)

Solid-glass beads (borosilicate, diam. 4 mm)

Phosphate buffer saline solution with Calicum and magnesium (cell culture grade) Preferable pack size of 100-500ml/pack

Phosphate buffer saline solution without Calicum and magnesium (cell culture grade) Preferable pack size of 500 - 1000 ml/pack

STAR Buffer (stool transport and recovery Buffer) 100 ml

Neutral red 0.33% solution, should be sterile-filtered, suitable for cell culture, must be available in concentration 3.3 g/L in DPBS. Preferable pack size of 100-500ml/pack

Neutral red available in powdered form as a biological stain with Dye content, ≥90%, should be available starting from a mininum pack-size of 1 gm Preferable pack size of 1 gm

Crystal violet solution available as 1% aqueous solution, should be used in both staining and also as a stain in cell proliferation assays. Preferable pack size of 50-100 ml

Crystal violet available in powdered form as a biological stain with Dye content, ≥90%, should be soluble in water at concentration of 1mg/ml Preferable pack size of 50-100 gm

0.1ml 96 well PCR plate, Half skirt fit, White, With sealing foil, Clear, Half Skirt, raised rim around each tube, DNAase/ RNAase free, Compatible with Cobas Z 480 Real Time PCR machine 50 plates/pack

Light Cycler 8 tubes strips white, Compatible with Cobas Z 480 Real Time PCR machine 120 strips / pack

MicroAmp optical 96-well reaction plate with barcode and optical adhesive films, Compatible with Quant Studio 5 and 7 Real Time PCR machine 100 plates/ pack

MicroAmp optical 8-tube strip with attached optical caps, 0.2 ml, Compatible with Quant Studio 5 and 7 Real Time PCR machine 125 strips / pack

0.2 ml optical 96-well reaction plate, Compatible with Bio-Rad CFX 96 Real Time PCR machine 50 plates/pack

Sealing foil for optical 96-well reaction plate, Compatible with Bio-Rad CFX 96 Real Time PCR machine 50 foil/pack

Filter Tips for 0.5 ul to 10 ul pipette, Sterile, low retention, Racked filter tip in box, 0.5 ul -10 ul Universal Graduation, DNAase/ RNAase free 10 box/ pack

10 ul microvolume filter barrier tips, ultra-low retention, high yield, polypropylene tips, non pyrogenic and RNase-/DNase-free certified, should fit a wide variety of single and multi-channel pipettes, compatible with most popular brands of pipettes, microvolume tips should have flexible walls and a series of internal sealing rings to ensure a secure fit with less force required to load and eject, preferable pack size of 960 tips. 10 box/ pack

Filter Tips for 2 ul to 20 ul pipette, Sterile, low retention aerosol barrier tips, Racked filter tip in box, 10 ul - 100 ul Universal Graduation, DNAase/ RNAase free 10 box/ pack

Filter Tips for 20 ul to 200 ul pipette, Sterile, low retention aerosol barrier tips, Racked filter tip in box, 20 ul - 200 ul Universal Graduation, DNAase/ RNAase free 10 box/ pack

Filter Tips for 100 ul to 1000 ul pipette, Sterile, low retention aerosol barrier tips, Racked filter tip in box, 100 ul - 1000 ul Universal Graduation, DNAase/ RNAase free 10 box/ pack

Micro centrifuge Tube 1.5ml, polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes, autoclavable, DNase, RNase/Endotoxin free, low/no binding affinity to protein and DNA for maximum recovery of sample, should have hinged click-lock lid to provide outstanding protection against unintentional opening during incubation and storage, centrifugation stability up to 30,000 × g to prevents sample loss due to tube breakage and provides extra safety when working with hazardous samples. 500 tubes/pack

Micro centrifuge Tube 2ml, polypropylene tubes, resistance to chemicals, mechanical stress and temperature extremes, autoclavable, DNase, RNase/Endotoxin free, low/no binding affinity to protein and DNA for maximum recovery of sample, should have hinged click-lock lid to provide outstanding protection against unintentional opening during incubation and storage, centrifugation stability up to 30,000 × g to prevents sample loss due to tube breakage and provides extra safety when working with hazardous samples. 500 tubes/pack

Freezer labels size: 33 x 13mm labels, ability to withstand cryogenic temperatures upto -80℃ and should adhere to wide variety of plastic and glass vials, test tubes, cryogenic boxes and plates without shrinking or peeling, resist moisture through repeated freeze and thaw cycles, white and rectangular in shape for 0.5 to 2.0mL cryogenic tubes or 15mL centrifuge tubes of size: 33x13mm Labels, should be available in rolls, prefered pack size of 1000 labels

Freezer labels size: 67 x 25mm labels, ability to withstand cryogenic temperatures upto -80℃ and should adhere to wide variety of plastic and glass vials, test tubes, cryogenic boxes and plates without shrinking or peeling, resist moisture through repeated freeze and thaw cycles, white and rectangular in shape for large tubes, cryogenic tubes or 15mL centrifuge tubes of size: 67 x 25mm (2.6 x 1.0") rectangle Labels, should be available in rolls, prefered pack size of 1000 labels Preferable pack size of 500-1000 labels/pack

Measuring cylinder- plastic 100ml, transparent, Plastic (polypropylene), graduated 1 item

Measuring cylinder- plastic 500ml, transparent, Plastic (polypropylene), graduated 1 item

Measuring cylinder- plastic 1000ml, transparent, Plastic (polypropylene), graduated 1 item

Powder free Nitrile Gloves, Small size, ISO 9001certified & FDA approved, CE Marked- EN455 & AQL 1.5, Should provide high degree of puncture and chemical resistance 100pcs per pack

Powder free Nitrile Gloves, Medium size, ISO 9001certified & FDA approved, CE Marked- EN455 & AQL 1.5, Should provide high degree of puncture and chemical resistance 100pcs per pack

Powder free Nitrile Gloves, Large size, ISO 9001certified & FDA approved, CE Marked- EN455 & AQL 1.5, Should provide high degree of puncture and chemical resistance 100pcs per pack

Autoclavable Biohazard Bag, Small size, Dimension 203 X 305, Autoclavable at 121℃, Should be in 2 thickness of polypropylene, Printed with Biohazard warning symbol, Should fulfill M.P Pollution Control Board norms 50-100pcs/pack

Autoclavable Biohazard Bag, Medium size, Dimension 356 X 483, Autoclavable at 121℃, Should be in 2 thickness of polypropylene, Printed with Biohazard warning symbol, Should fulfill M.P Pollution Control Board norms 50-100pcs/pack

Autoclavable Biohazard Bag, Large size, Dimension 483 X 584, Autoclavable at 121℃, Should be in 2 thickness of polypropylene, Printed with Biohazard warning symbol, Should fulfill M.P Pollution Control Board norms 50-100pcs/pack

PPE Kit, for Swine flu testing, should include gown, head cover, googles, N-95 mask, triple layered mask, sterile gloves and shoe cover 1 item

N-95 Mask, Particulate Respirator with valve, NIOSH approved with adjustable nose clip, Ultrasonically welded headbands, polypropylene filter, polyester shell, disposable, coolflow exhalation valve, Preferable pack size of 10 nos. in one box 1 item

N-95 Mask, Particulate Respirator without valve, NIOSH approved with adjustable nose clip, Should protect against airborne biological particles. fluid resistant, disposable, CE marked, cup shape half mask type, Should remove 95% of all particles that are at least 0.3 microns in diameter, Preferable pack size of 20 nos. in one box. 1 item

Tissue wipes, lint free, white, for light cleaning tasks in the laboratory, Sheet size preferably of length size: 14.7" x 16.6", Should easily wipe up liquid and dust, Should also be ideal for cleaning and wiping delicate surfaces such as lenses, slides, optical lenses, optical instruments, surfaces, glass layer 140-280sheet/pack

Rnase wipes, For complete removal of Rnase contamination from work surfaces, pipettes and equipments should be provided in towel format, should be stable at room temperature, preferable pavck size of 100 wipes. 50-100 wipes/box

Tissue roll (Size 20M) 1 item

Cryo Pen permanent marker, fine tip, alcohol resistant and water resistant, for labelling cryovials, should withstand temperatures up to -200 ℃, ink in the marker pen should be fast drying, non-smearing and permanent. 1 item

Aluminium foil, 30 meters, 11 micron thickness 1 item

Surface Disinfectant (containing Benzalkonium chloride 20%, Cetrimide 0.5%, Isoprophyl Alchohol 5%) 500-1000ml/pack

Filter paper, 3 mm sheets (46 X 57 cm) 100pcs per pack

Digital Timer, Compact for Lab, with Alarm, Large Digital LCD Display, with Table Stand & Magnet 1 item

Refrigerator thermometer, should detect from -20 to 60 ℃, Calibrated, Compact and accurate, should provide crucial temperature readings for lab applications. 1 item

Freezer thermometer, should detect upto -100℃, Calibrated, Compact and accurate, should provide crucial temperature readings for lab applications. 1 item

Hot Air Oven Tape, 50 meter, 19mm width, to be used as indicators for dry heat sterilisation (30 minutes at 155 °C), colour change after heating, ISO marked.

Autoclave Tape, 50 meter, 18mm width, to be used in high vacuum, high temperature steam autoclaves and other high temperature sterilisation sysytem, colour change from white to visible brown/ black should take place on complete sterlisation through moist heat.

Microscopic Glass slide, size 75 mm x 25mm x 1.25mm, high quality white glass with low iron content, corrosion-resistant, slide edges should be ground smooth to help eliminate sharp cutting surfaces and safe handling, Slides should be packed in thermoform plastic box to minimize exposure to moisture and dust, 70-80 slides per box should be present for packaging. 100pcs per pack

Polypropylene cover slip (1.0mm) 100pcs per pack

8-Tube Strip Adapter Plate compatible with light Cycler and Cobas z480

Microwell plate (AD plate 0.3ml) for real time PCR cobasz480 machine 50 plates/pack

PCR microtiter plate sealing foil 50 /pack

Micropipette tips 20 ul to 200 ul 500 /pack

Micropipette tips 2 ul to 20ul 500 /pack

Micropipette tips 100 ul to 1000 ul 500 /pack

Micropipette tips 0.5 ul to 10 ul 500 /pack

5 ml storage Tube 500 /pack

5 ml Long-Term Storage Cryogenic Tubes with screw caps 500 /pack

Polypropylene Storage box for 5 ml tubes 10 /pack

50 ml Sterile, certified nonpyrogenic and DNase-/RNase-free,disposable conical bottom polypropylene (PP) tubes with seal caps. The tubes should have black printed graduations and a large white marking spots. 500 /pack

15ml Sterile, certified nonpyrogenic and DNase-/RNase-free,disposable conical bottom polypropylene (PP) tubes with seal caps. The tubes should have black printed graduations and a large white marking spots. 500 /pack

10ml polypropylene, round bottom, autoclavable, non-sterile centrifuge tubes with a sealing cap that can be used upto 50,000 x g -100000xg in refrigerated or non-refrigerated centrifuges 500 /pack

30 ml polypropylene, autoclavable, non-sterile centrifuge tubes with a sealing cap that can be used upto 50,000 x g -100000xg in refrigerated or non-refrigerated centrifuges 500 /pack

50 ml conical bottom centrifuge tubes polypropylene, autoclavable, non-sterile centrifuge tubes with a sealing cap that can be used upto 50,000 x g -100000xg in refrigerated or non-refrigerated centrifuges 500 /pack

Polystrene Collection Tube 10ml 500 /pack

Parafilm Parafilm Dispensor, plastic 1 item

1.8 ml Cryogenic vials, sterile, internal thread 500 /pack

1.8 ml Cryogenic vials, sterile,external thread 500 /pack

Storage Boxes for -80°C / -20°C of polypropylene with transparent lid 10 /pack

Storage Boxes for -80°C / -20°C cardboard box 10 /pack

Screw cap 2 ml tubes 500 /pack

0°C lab top cooler for 0.5/1.5/2.0ml; capacity 20 tubes 1 item

Cool box for reagents (2ml vial) with 20 vial capacity and PCR 96 well plates 10 /pack

Microcentrifuge tube rack (80 tube/96 tube capacity) reversible one side for 1.5ml tube and other side with 0.2 ml PCR tubes 10 /pack

Microcentrifuge tube rack (20 tube/24 tube capacity) for 1.5/2ml tube 10 /pack

0.2ml PCR tube (sterile, flat-cap shaped) 500 /pack

0.2ml PCR tube (sterile,dome-cap shaped) Dnase/ Rnase free for molecular biology applications 500 /pack

0.5ml PCR tube (sterile, safe lock cap) 500 /pack

0.5ml PCR tube (sterile, flat-cap shape) 500 /pack

Wide Mouth Wash Bottle Capacity 500 ml 1 item

PCR tube Work-up rack with 96 well for 96 tubes in 8x12 format, can also hold 8 or 12 tube strips 10 /pack

PCR tube storage rack for 96 tubes 10 /pack

Pipette Stand (5 place) 1 item

Cryo cube box 80/100 well capacity for storage of cryogenic samples in 1-2 ml cryotube tube, plastic with transparent lid 10 /pack

Cryo box 5X10 well for 1.5 ml/2ml tubes 10 /pack

Pasteure pipettes 3ml 500 /pack

Reagent Reservoir (ELISA) 10 /pack

Cryo gloves (M size) 1 item

Cryo gloves (L size) 1 item

Freezing tubes (1.5ml) 500 /pack

Microtube rack with lid, the rack should be able to hold 0.2mL strips and 1.5mL tubes on one side and 0.5 ml on other side 10 /pack

Parafilm roll (6 inch), 50 meter roll/ pack 1 item

Reversible rack (96 places) 10 /pack

Reversible rack (80 places) 10 /pack

Freezer Storage Racks, reusable hinged lid racks available in 50-100 place, can accommodate 1.5/2.0 mL microtubes Lids must have raised edges for non-slip storage of multiple racks, racks should have alphanumeric markings 10 /pack

50 ml centrifuge tube rack 10 /pack

50 ml centrifuge tube rack (polypropylene),10-30 places, 10 /pack

15 ml centrifuge tube rack 10 /pack

15 ml centrifuge tube rack (polypropylene), 10-30 places, 10 /pack

Universal combi rack 10 /pack

Test tube stand 10 /pack

Ice Bucket (5 lit) 1 item

Ice Scoop 1 item

Gel Scoop 1 item

Hand protector grip (For Microwave oven) 1 item

Borosil lab tough glass bottle (50 ml) 1 item

Borosil lab tough glass bottle (100 ml) 1 item

Borosil lab tough glass bottle (500 ml) 1 item

Borosil lab tough glass bottle (1000 ml) 1 item

Borosil labtough glass bottle (2000 ml) 1 item

UV safety googles 1 item

Saftey face shield 1 item

Multipurpose labeling tag 1000 /pack

Polystyrene weighing boats 100 /pack

Spatula (Stainless Steel) Small size 1 item

Spatula (Stainless Steel) Medium size 1 item

Spatula (Stainless Steel) Large size 1 item

Glass Conical flask, Autoclavable (50ml) 1 item

Glass Conical flask, Autoclavable(100ml) 1 item

Glass Conical flask, Autoclavable (250ml) 1 item

Glass Conical flask, Autoclavable (500ml) 1 item

Glass beaker, Autoclavable (50ml) 1 item

Glass beaker, Autoclavable (100ml) 1 item

Glass beaker, Autoclavable (250ml) 1 item

Plastic beaker, Polypropylene, Autoclavable, (100 ml) 1 item

Plastic beaker, Polypropylene, Autoclavable, (500 ml) 1 item

Plastic beaker, Polypropylene, Autoclavable, (1000ml) 1 item

Disposable serological pipettes (1ml) 100 /pack

Disposable serological pipettes (2ml) 100 /pack

Disposable serological pipettes (5ml) 100 /pack

Disposable serological pipettes (10ml) 100 /pack

Cryo tags/ Tough tags 100 /pack

Measuring cylinder-glass (100ml), transparent, graduated 1 item

Measuring cylinder- glass (500ml), transparent, graduated 1 item

Measuring cylinder- glass (1000ml), transparent, graduated 1 item

Measuring cylinder- plastic 100ml, transparent, Plastic (polypropylene), graduated 1 item

Measuring cylinder- plastic 500ml, transparent, Plastic (polypropylene), graduated 1 item

Measuring cylinder- plastic 1000ml, transparent, Plastic (polypropylene), graduated 1 item

Syringe filter (PVDF membrane),(0.22 µ) 50 /pack

Syringe filter (PS membrane), (0.22 µ) 50 /pack

Syringe filter (PVDF membrane), (0.45 µ) 50 /pack

Syringe filter (PS membrane), (0.45 µ) 50 /pack

Cool-Box-20 degree (size 96x0.2ml, which maintain temperature below-15degree C for approx.. 2 hourss after removal from freezer, made of polycarbonate,body filled with non-toxic gel, equipped with an aluminum block to hold tubes strips or plates, with transparent lid 1 item

Cool Box - 20˚C, cylindrical shape (size 12X1.5ml micro centrifuge tubes) maintain temperature below- 15˚ C for approx. 2 hours after removal from freezer with screw cap 1 item

Digital Thermometer (0◦-200◦C) 1 item

Digital Thermometer (-80◦C) 1 item

Wide mouth plastic autoclavable bottle with screw cap 250ml 1 item

Wide mouth glass bottle with screw cap autoclavable p.p. 500ml 1 item

Stool collection vials with screw capped with spoon 100 /pack

Spirit for Disinfection (70% Ethyl Alcohol) 10 litres

Autoclave indicator tape, (chemical indicator,change colour to dark brown or black, after processing), width 18mm, length 50 m. 1 item

Micropipette for volume 0.5-10ul, with built in ejector, autoclavable tip cones, easy to caliberate and maintain, easy to disassemble for autoclaving. As per ISO 9001:2008/ CE marked. Calibration certificate must be provided. 1 item

Micropipette for volume 2-20ul, with built in ejector, autoclavable tip cones, easy to caliberate and maintain, easy to disassemble for autoclaving. As per ISO 9001:2008/ CE marked. Calibration certificate must be provided. 1 item

Micropipette for volume 10-100ul, with built in ejector, autoclavable tip cones, easy to caliberate and maintain, easy to disassemble for autoclaving. As per ISO 9001:2008/ CE marked. Calibration certificate must be provided. 1 item

Micropipette for volume 10-200ul, with built in ejector, autoclavable tip cones, easy to caliberate and maintain, easy to disassemble for autoclaving. As per ISO 9001:2008/ CE marked. Calibration certificate must be provided. 1 item

Micropipette for volume 100-1000ul, with built in ejector, autoclavable tip cones, easy to caliberate and maintain, easy to disassemble for autoclaving. As per ISO 9001:2008/ CE marked. Calibration certificate must be provided. 1 item

Multichannel pipette (8 channel) 5-50ul, with built in ejector, autoclavable tip cones, easy to caliberate and maintain, easy to disassemble for autoclaving. As per ISO 9001:2008/ CE marked. Calibration certificate must be provided. 1 item

Multichannel pipette (8 channel) 10-100ul, with built in ejector, autoclavable tip cones, easy to caliberate and maintain, easy to disassemble for autoclaving. As per ISO 9001:2008/ CE marked. Calibration certificate must be provided. 1 item

Multichannel pipette (8 channel) 20-300ul, with built in ejector, autoclavable tip cones, easy to caliberate and maintain, easy to disassemble for autoclaving. As per ISO 9001:2008/ CE marked. Calibration certificate must be provided. 1 item

Multichannel pipette (8 channel) 100-1000ul, with built in ejector, autoclavable tip cones, easy to caliberate and maintain, easy to disassemble for autoclaving. As per ISO 9001:2008/ CE marked. Calibration certificate must be provided. 1 item

Automated Pipette gun (Motorized pipet controller) (Bio-Hit/Corning/Eppendorf/Tarson) 1 item

Whatman filter paper no.1 ( 125 mm) 1 item

Scalpel 50 / pack

Washing Brush with Full radial tip for washing bottles, cylinders and large test tubes 1 item

Washing Brush with Fan tip for cleaning test tube and narrow mouth glassware. 1 item

Washing brush with fan shape tufted end of Stiff, black bristles 127 mm long x 64 mm diameter, for cleaning cylinders or large tubes 1 item

Laboratory Drying racks for glasswares/plasticwares 1 item

Teepol (Multipurpose detergent) 5 litres

MagNA Pure 24 Total NA Isolation Kit 96

MagNA Pure 24 Processing Catridge 48

MagNA Pure 24 Tip Park (With Piercing Tools) 48

MagNA Pure 24 Tip 1000ul 3840

Framestrip with flat caps high Profile 120

MagNA Pure Sealing Foil 100

MagNA Pure DNA tissue Lysis Buffer, 100 ml

MagNA Pure Bacteria Lysis Buffer 20 ml

Department of Cardiothorasic Surgery Nova Blood Gas Requirement

Calibrator cartridge CCS comp Code3822

Prime sensor card CCS Code 9027

Prime Tubing Harness Code 9027

Prime Reference Cartridge Code 9027

Calibrator cartridge CCS comp Code3822

Prime sensor card CCS Code 9027

Prime Tubing Harness Code 9027

Prime Reference Cartridge Code 9027

Annual Requirement of Na-K Analyzer Carelyte

Cle 001Set 1

Pump Tubing set 1

Electrolyte Filling 1

Reference Filling 1

Complete Tubing Set 1

Paper Roll 1

Department of Biochemistry Required Equipment Compatable Kits Only

Ammonium Sulphate 500 gm

Benzidine Powder 500 gm

Barium Chloride 500 gm

Cupric Acetate 500 gm

Creatinine Powder 500 gm

Caesine Powder 500 gm

Formaldehyde 500 ml

Fructose Powder 500 gm

Glucose Powder 500 gm

Gelatin Powder 500 gm

Lactose powder 500 gm

Mercuric Chloride 500 gm

Maltose Powder 500 gm

Phenyl Hydrazine Hydro Chloride 500 gm

Resorcinol 500 gm

Sodium Nitro prosside 500 gm

Sodium Hydroxide 500 gm

Sodium Tarcholate 500 gm

Sodium Meta bisulphate 500 gm

Sucrose Powder 500 gm

Starch 500 gm

Sodium Chloride 500 gm

Sodium Nitrite 500 gm

Sulphuric Acid 500 ml

Hydro chloric Acid 500 ml

Glacial Acitic Acid 2.5 Littre

Nitric Acid 2.5 Littre

α-Napthol 500 gm

Phloroglucinol powder 500 gm

Ninhydrine powder 500 gm

Hydrogen peroxide 500 ml

Liquor ammonia 500 ml

Chloroform 500 ml

Albumin powder 500 grm

Ethanol(Abs.Alcohol) 500ml

Ammonium Molebdate 500gm

Mercuric sulphate 250gm

Bromine Ampule (5x20ml) (pack size)

Burning Spirit 5 Liter

Sodium Tungstate 100 gm

Lead oxid (Yellow) 500 gm

Silver Nitrate 500 gm

Urea Powder 100 gm

Murcuric Sulphate 100 gm

Megnsium Sulphate 500 gm

Uric Acid 100 gm

Trichlora Acitic Acid 500 gm

Frerric Chloride 500 gm

Cupper Sulphate 500 gm

Ammonium Oxalate 500 gm

Sulpher Powder 500 gm

Bromocresal green (liquid) 100 ml

Picric acid 500 gm

Phenopthline Indicator 500 gm

Lead acetate 500 gm

Orthophosphoric acid 500 gm

Sodium Carbonate 500 gm

Lactic Acid 500 ml

Barium Nitrate 500 ml

Barium Hydroxide 500 ml

Potassium Chloride 500 gm

Sodium Phosphatase (Hydrated) 500 gm

N-butanol 500 ml

Amino Acids for paper chromatography (MBBS Practical) 5, 10 gm

Sodium Citrate 500 gm

Sodium Meta bisulphate 500 gm

Methanol 2.5 Littre

Tannic acid 500 gm

L-Tyrophan 10 gm

L- Alanine 10 gm

L-Arginine 10 gm

L-Aspartic acid 10 gm

L-Cysteine 10 gm

L-glycine 10 gm

L- tyrisine 10 gm

L- serine 10 gm

L- histidine 10 gm

L- methionine 10 gm

L- phenyl alanine 10 gm

Phenol (carbotic acid) 10 gm

phaspho malybdic acid 10 gm

PhasphoTungstate 500 gm

Potassium Hydroxide 500 gm

Sodium Acetate 500 gm

Sodium Carbonate 500 gm

Sodium Hypo chloride 500 gm

Sodium Tungstate 5 Liter

Acetone 500 ml

Calcium Chloride 500 gm

Ferrous Sulphate 500 gm

Bilirubin Powder 10 gm

(2) Glass ware required for UG Lab

Beaker 100 ml

Beaker 250 ml

Beaker 500 ml

Beaker 1000 ml

Beaker 2 liters

Beaker 25 ml

Volumetric Flask 100 ml

Volumetric Flask 500 ml

Volumetric Flask 250 ml

Funnel 4 diameter

Flat Bottom Flask 1000 ml

Flat Bottom Flask 2 liters

Merking Acid Bottles (Hcl) Litre

Merking Acid Bottles (H2So4) Litre

Merking Acid Bottles (HNo3) Litre

Dropping Bottles Brown (25 ml)

Dropping Bottles Plane (25 ml)

Reagent Bottle 100 ml

Test tube 18x150 inch

Test tube 15x125

Test tube. Vail (glass) ML

Spirit Lamp ML

Test tube's Holder ML

Fallin Uw Tube ML

Slide Glass ML

Cover Slip ML

Doramess Urea Meter ML

Measuring Clyinder 1000 ml

Measuring Clyinder 500 ml

Measuring Clyinder 250ml

Measuring Clyinder 50 ml

Test tube stand ML

Drapper (big size) ML

Spirit Lamp ML

(3) Plastic Items & others

Tips (10-200 ul) 1000 no

Tips (10-1000 ul) 500 no

Allicates 100

Clot Vaccutainer 100

Distill Water (ltr) 5 ltr

Tissue Paper Roll 1 ml

Tips for auto Pipette (10-100 ul) 1000 ML

Tips for auto Pipette (100-1000 ul) 1000

Tips for auto Pipette (200-1000 ul) ML

Tips for auto Pipette (2-100 ul) 1000

Syringe (2 ml)

Syringe (5 ml)

Gloves (6 no)

Gloves (6.5 no)

Gloves (7 no)

EDTA Vacuutainer

Sodium Hypocloride 5 ltr

Sodium Floride tube

Spirit 450 ml

Test Tube Stand 12 tube

Tips stand (small)

Tips stand (Big)

Dustbin Red

Dustbin Black,

Dustbin Blue,

Dustbin Yellow,

Poly Bag Red

Poly Bag Black,

Poly Bag Blue,

Poly Bag Yellow, 1200 no

(4) Open system kits for Thyroid Test

T3 96 well

T4 96 well

TSH 96 well

(5) Open system kits for other Test

Troponin-I (card) 10 Pack

6) KITS FOR SEMI AUTOANALYSER (UG Practicals)

Glucose GOD-POD

Urea Birth lot

Uric Acid

Cholesterol CHOD-PAP Method

Total Protein Biurate

Albumin BCG Colorimetric test

CSF Protein Turbidometric (end point)

SGOT IFCC/UV-Kinetic method

SGPT IFCC/UV-Kinetic method

Alkaline Phosphatase PNPP-AMP Kinetic Assay

Triglyceride

HDL Cholestrol

Serum Bilirubin JENDRASSIK & GROF Method

Serum Creatinine Jeff' s Reaction (Alkaline Picric method)

Serum Calcium

Serum Phophorus

B) List of kits for Close System Required Equipment Compatable Kits Only Fully automated chemistry analyzer

Glucose 600 ml

Urea 600 ml

Serum Creatinine 600 ml

SGOT 600 ml

SGPT 600 ml

Alkpo4-AMP 300 ml

Total Bilirubin 600 ml

Serum Direct Bilirubin 300 ml

Serum Protein 600 ml

Serum albumin 600 ml

Cholesterol 600 ml

Triglyceride 600 ml

HDL Cholesterol 200 ml

LDL Cholesterol 160 ml

Serum Uric acid 600 ml

Serum Calcium 600 ml

Serum Phosphorus 170 ml

Serum Amylase 150 ml

Serum Lipase 60 ml

CPK (CK) 150 ml

CK MB 150 ml

Serum Ferritin 120 ml

HBA1C 144 ml

Biochemistry Calibrator 5x5 ml

Wash Solution Concentrate

Reaction Rotor 10x100

PD Cups 1000/pack

Extran MA 02

Electrolyte analyser (Carelyte Electrolyte)

Calibrator Solution 1& 2(Carelyte Electrolyte Analyzer) Cal1- 500 ml Cal 2-200 ml

Enzyme Cleaning Solution 1x15 ml

Sodium Conditioner 1x15 ml

Electrolyte analyser (Carelyte Electrolyte)

Reagent Pack (Careline Electrolyte Analyzer ) Cal A- 650 ml Cal B-200 ml

Control Level 1 5X1 ml

Control Level 2 5X1 ml

D-Proteinization Solution 5X1 ml

Sodium Conditioner 5X1 ml

Cleaning Solution 5X1 ml

Automated Hydrasis Scan Gel Electrophoresis

Protein Electrophoresis in blood (serum kit) Code no.7004058 200 test

Normal Control SerumCode no.58305 1 x1 ml

Wash Solution Code No. 58595 10x80 ml

Destaining solution Code no.58694 10x100 ml

Hb Electrophoresis

HPLC SYSTEM(BIORAD) D-10

D-10 Hemoglobin A1C Program Recorder Pack (Code no-220-0101) 400 test

D-10 Printer Paper (Code No-220-0375)

Liquichek Diabetes Control Level 1 (Code no 171) 6x1 ml

Liquichek Diabetes Control Level 2 (Code no 172) 6x1 ml

Department of Pathology Kits for Automatic Hematology cell counter ( 5-part)

Diluent (M 53) 500 ml x 1 pack

Lyse (M 53) LH 500 ml x 1 pack

Lyse (M 53) Leo (II) 400 ml x 1 pack

LEO (M 53) Leo (I) 1000 ml x 1 pack

Cleanser (M 53) 1000 ml x 1 pack

Probe cleanser 50 ml x 1 pack

Quality Control 3x3 ml x 1 pack

Calibrator 3x3 x 1 pack

Kits for Automatic Hematology cell counter ( 3-part) Part – 3 (Mindray BC – 3600)

M 30 D Diluent 20 lit x 1 pack

M 30 R Rinse 20 lit x 1 pack

M 30 CFL lyse 500 ml x 1 pack

Probe cleanser M 30 17 ml x 1 pack

Quality Control 3x3 x 1 pack

Paper Roll

Calibrator 3x3 x 1 pack

Transasia 5- Part cell counter

Cell Pack 20 1lt x 01 pack

Stromatolyzer HDL 5 1 lt x 01 pack

Stromatolyzer HDS 42ml x 3x01 pack

Sulfolyzer 51lt x 01 pack

Cell Clean 50ml x 01 pack

E. Check Trilevel 15ml x 3x 01 pack

SCS 1000 Calibratar 2ml x 01 pack

E. Reagents, kits, chemicals and glassware

PT kit(Time) (Ist 1.00-1.20) 12x5 ml

APTT 12x5 ml

FDP kit 1x4 ml (Manual)

D-Dimer 1x4 (Manual)

Thrombin time kit 10x1 ml (Manual)

Factor VIII deficient plasma(<1%) 10x1 ml Manual)

Factor IX deficient plasma (<1%) 10x1 ml Manual)

G-6- P-D kit 100 tests

Benedict’s Qualitative reagent 1x5 lit

Absolute alcohol (Ethanol) 1x500 ml=500 ml

Isopropyl alcohol (Propanol) 1x2.5 lit

XYLENE (sulphur free) 1x2.5 lit 1x2 lit

DPX 1x250 ml

EA- 50(Modified) (for cytology) 1x12 ml

OG6(for cytology) 1x12 ml

Paraffin Wax Histology (58-600C) 1x1 kg=1 kg

Haematoxyline powder 1x2 gm

Haematoxyline solution (harris) 1x125 ml

Formaldehyde 40% (Conc. Formaline) 1x30 lit

Filter paper Sheet (Whatmann no-01)

Filter paper (whatmann no- 40 ( 10 cm. circle) original

Reticulocyte kit 100 tests

Leishmann stain sol. with buffer tablet pH 1x500 ml

Methanol (Acetone free) for leishman staining 1x2.5 lit

Esbach’s reagent 250 ml

Occult blood test kit (Haem test kit) 1x100 strips

Ehrilich’s aldehyde reagen 2x250 ml=250 ml

Poly L-Lysine sol, (for immunohisto chemistry) 1x100 ml

Poly L-Lysine coated slides 1x50 slides

Iron alum (Aluminum Potassium sulphate) 1x500 ml

Silver nitrate 1x25 gm

Drabkin’s solution 1x5 lit

Vaccutainer plain with needle holder

Vaccutainer plain EDTA (k3 vial with needle holder) 1x1000

Hypochlorite so. (Conc.) 1x05 ml

Immersion Oil (merck/span) 1x250 ml

Coverslip (22x50 mm) (Blue star Fact) 1 box x 20 packet

Coverslip (22x22 mm) (Blue star Fact) 1 box x 20 packet

Glass Slides Blue Star 1x50 Packet

Test tube glass (12x100) Borosil/Pyrex 100 tubes

Test tube glass (12x75) Borosil/Pyrex 100 tubes

Diamond pencil For slide marking

Glass capillary tube 1x100

ESR Wintrobe tube Glass

Tissue pape rol.

Running water tray

Plastic apron

Tips (micropipette) (5-200ml) & Tips (micropipette) (200-1000ml) 1000 tipsx1packet

Test Tube (polysterence/polypropylene) (12x100mm) 100 tubes

Test Tube (polysterence/polypropylene) (12x75mm) 100 tubes

Lancet 1X200 No's

Strips for urine albumin And sugar 1x100 strips

Protein for CSF (Calorimeter) 100 tests

Albumin for CSF (Albumin) 100 tests

Rubber globs 6.5, 7.0, 7.5 size 100x1 Box each

10 ml Syring (piston with rubber bang)

AFB kit

Cytospin filter card (Thermo) 1 Box x 200 no's

Mictome Blades (Thermo) 50x1 Box

Citric Acid 500 gm

Tri sodium citrate ANALAR/GR/AR 500 gm

Sodium di-hydrogen phosphate ANALAR/GR/AR 500 gm

Disodium hydrogen phosphate (anhydrous) 500 gm

Sodium chloride ANALAR/GR/AR 500 gm

Metylyne blue 500 ml

Carbol fuchsin 500 ml

Disposable Syringe 5ml

Disposable Syringe 20ml

Tris (Hydroxy-methyl) amino methane 500 gm

PAS staining Kit

PTAHstaining Kit

Masson -trichrome staining kits

Microtome Blade (Spencer's Rotary)

Semen diluting fluid 125 ml

WBC diluting fluid 500 ml

Sulphur powder 1x500 gm

Micropipette 10 to 100 micro lt.

Micropipette 05 to 50 micro lt.

Micropipette 1000 micro lt.

Test tube holder

Manual cell counter

Ehrilich’s aldehyde reagents 1x250 ml

Neubar’s counting chamber (imported)

Urino meter for specific gravity urine

May Grunewald giemsa stain

Fouchet reagents

Paraffin wax Histology (60-62 0C) merck 1x1 kg

Eosin (SS) powder 1x25 gm

Eosin 2% solution 1x25 ml

Coomb’s serum (anti human globulin) polyvalent 1x05 ml

Bovine albumin (22% W/V) 1x05 ml

Hydrogen peroxide (conc.) H2O2 1x500 ml

Glacial acetic acid

Liquor Ammonia 1x500 ml

Pandy’s reagents CSF

Iron alum-(Almunium Potassium sulphate) 1x500 gm

Distilled water 1x5 lt.

KH2PO4 (anhydrous) 1x500 gm

Bone marrow aspiration needle steel

Coplin jar Glass/Plastic

Aluminium rack for 12x100 glass tubexlarge tube 15x150 mm Aluminium

Forcep big (steel high quality) 6” Big size

Forcep-Small 4” Big size

Scissors medium 6” Big size

Field stain A 1x500 ml

Field stain B 1x500 ml

Tris Buffer (Powder) 500 gmx1

Conc. Sulphuric acid 1x500 ml

Mucicarmine Stain 1x500 ml

Reticuline Stain 1x500 ml

Bone Marrow Biopsy Needle steel

Plunger (Cytology) For 10ml & 20ml syringe Steel

Disposable Base Modules for Embradding rings

Thermo Cryotome (FE) Block Holders

Immunohistochemistry Kits

ER immuno 1x6 ml

PR immune 1x6 ml

Her-2 /Neu 1x6 ml

HPV-16 & HSV Immuno stains 1x6 ml

Proliferative Marker-P-53 1x6 ml

Proliferative Marker-Ki 67 1x6 ml

Pancytokeratin 1x6 ml

CK-7 1x6 ml

CK-20 1x6 ml

EMA 1x6 ml

CEA 1x6 ml

HMWCK 1x6 ml

AFP 1x6 ml

Vimentin 1x6 ml

Desmin 1x6 ml

NSE 1x6 ml

Chromogranin 1x6 ml

Synaptophysin 1x6 ml

SMA 1x6 ml

C-kit/CD-117 1x6 ml

CD-34 1x6 ml

CD-31 1x6 ml

LCA 1x6 ml

Bcl-2 1x6 ml

BCL-6 1x6 ml

CD 3 1x6 ml

CD 5 1x6 ml

CD 10 1x6 ml

CD 20 1x6 ml

CD 15 1x6 ml

CD 1A 1x6 ml

CD 30 1x6 ml

CD 68 1x6 ml

CD 99 1x6 ml

Alk-1 1x6 ml

CA-125 1x6 ml

HMB-45 1x6 ml

GFAP 1x6 ml

Myoglobin 1x6 ml

CD 19 1x6 ml

PLAP 1x6 ml

CD 33 1x6 ml

MPO 1x6 ml

Lecognost ALPA 1x6 ml

Leecognost EST 1x6 ml

Leecognost PAS 1x6 ml

Leecognost POX 1x6 ml

Leecognost Basic set 1x6 ml

Hematognost Fe 1x6 ml

Basic set/reduction set 1x6 ml

TTF 1 1x6 ml

Mannual kits for liquid based cytology 1x6 ml

CD-34 1x6 ml

CD-31 1x6 ml

LCA 1x6 ml

Andriogenreceptro 1x6 ml

Myogenin 1x6 ml

Fully Automated Coagulation Analyzer

STA Neoplastin CL+10 (for PT test code- 00667) 12x10ml

Cephascreen - 10 (For APTT Test) code-00310 12x10ml

STA Thrombin-2 (for TT test) code- 00611 12x2ml

STA coag control N+P 00679 12x2x1 ml

STA CaC12 0.025 M code-00367 12x15 ml

STA cuvettes code- 38669 06x1000

STA Cleaner Solution 00973 06x2500 ml

STA Desorb U code- 00975 24x15 ml

STA Pool Norm code- 00539 12x1ml

STA Immuno def. FVIII (for FVIIII Assay) Code-0728 6x1 ml

STA Immuno def. FIX (For FIX Assay) Code-0734 6x1 ml

STA satelite cuvetter 39430 6x200

STA Lia test D-Di plus Code-00662 6x6 ml

STA Liatest control N+P code-00526 12x2x1 ml

STA Lia test vWF:Ag Code-00518 4x5ml

STA vWF AG calibrator Code-00520 6x1ml

STA staclot DRVV screen-2 (for lupus anticoagulant) Code-00339 12x2ml

STA staclot DRVV confirm Code-00334 12x2ml

STA control LA 1+2 Code-00201 3x2x1ml

Requirement of HPLC

Bio RAD D-10 TM Dual program

Lyphocheek Control 500 tests per kit

Plastic Aliquots (sample vials 1.5 ml) 1.5 ml per pack

Micropipettes 100-1000 micro lt. 5-500 micro lt.

Microtips+Marotips Large Small

HIC tagged anti human

C4d (transplant)

Fibrinogen

Kappa (kidnev only)

Lambds (kidnev only)

FITC (Florescent isothiayanate)

Rhodaminc

Feulgen stain

Michel’s medium (transport medium)

Cytochemistry Kits

Make Thermo

Cytospin filter cord (thermo) 1 box x200 ns

Microtome blades (thermo) 34c/8 0mm 1 box x 50 blades

Microtome blades HP ultra 340 C/75 5 mm 1 packx blades

Cryomatrix gel thrmo 1 pack x 120 ml

L-shape mold (brass) 6x3x2 cm-01 pack

Cyto slide clip 12x1 pack

Sample chamber cup (reusable) Cytospin 12x1 pack

Microtome blades (spencer rotary) higy & low protila 1 box x 10 blades

Nephrology LAB. Medicine Department

Serum Glucose Kits 2 X 500 ml

Blood Urea Kits 2 X 125 ml

Serum Creatinine 2 X 125 ml

Semi Auto Analyzer 1 (One)

Water Bath 1 (One)

Micro Pippet Adjustable 1000 ul 500 ul 100 ul

WARD SIDE LAB

ABX MINDIL 20 lit.

ABX MINI CLEAN CLEANER 1 lit.

ABX MINI LYSEVIO 400 ml.

ABX MONO CLAIR 100 ml.

URINE STRIP 100 Strip

Photo Electric Colorimeter AE – 11M 1 (One)

Drabkin’s Reagent 5 lit.

Methanol 2½ lit.

Field Stain A 500 ml.

Field Stain B 500 ml.

Micro Pipette (adjustable) 1000 µl.

Micro Pipette adjustable 20 µl.

Centrifuge Machine (REMI) Laboratory 1 (One)

Micro glass slide 75mm X 25 mm X 1.25 mm.

Test tube borosil (without rim) 12 X 100

HONEY ENTERPRISES

ACCURATE MARKETING

CHIRAG SCIENTIFIC SALES

Arck Enterprises

Udit Agencies

CHANNEL TEN

TECHNOCHEM ASSOCIATES