Loading…
Loading…
| # | Company | Amount | Rank | Status |
|---|---|---|---|---|
| 1 | L-1₹56,255Accepted-AOC 351 BMK GIRI NAG KALKAJI NEW DELHI 110019 | NEW DELHI | SOUTH EAST DELHI | DELHI | 110019 | L-1 | Accepted-AOC Accepted as L-1 for few items | |
| 2 | L-1₹1.0 LAccepted-AOC | L-1 | Accepted-AOC Accepted as L-1 for few items | |
| 3 | L-2₹10.5 LRejected-AOC | L-2 | Rejected-AOC Rejected |
Tender Value
₹7.6 L
EMD Value
₹22,757
Closing Date
6 Oct 2022, 4:00 pmClosed
Principal, College of Vety Sc and AH, RK Nagar
College of Veterinary Sciences and AH, RK Nagar
Procurement of laboratory consumables under the SERB DST sponsored research projects for the Department of Veterinary Pathology, College of Veterinary Sciences and AH, RK Nagar, West Tripura for the year 2022
2022_ARDD_32158_1
CRG-4/CVS/PATH/SERB-DST/2022
Open Tender
Laboratory and scientific equipment
Item Wise
90 days
College of Veterinary Sciences and AH, RK Nagar
Please refer Tender documents.
8 documents required · 8 mandatory
₹1,000
Yes
₹22,757
Yes
10 Jan 2023
14 Sept 2022
7 Oct 2022
14 Sept 2022
6 Oct 2022
14 Sept 2022
Amount
Micro glass slide, Frosted-50nos/box, Brand: Blue star/Merck/Thermo Fisher Scientific
Cover slip-100 pc/box, Brand: Generic /Merck/Blue star
Test tubes with cork lid - 15 ml-pack of 10pc, Brand: Generic /Merck/Thermo Fisher Scientific
Test tube holder-brass-Brand: Harpal son/Merck
Volumetric flask with cap- 1000ml, Brand: EISCO/Merck
Volumetric flask with cap--250ml, Brand: EISCO/Merck
Tissue Specimen Jar, Clear transparent glass with lid--Vol:1.2 L, Brand: Borosil/S Science
Glass Beaker (graduated) -- 250ml, Brand: WitegScientific/EISKO/Glassco/Thermo Fisher Scientific
Glass Beaker --500ml, 6pc/pack, Brand: LFAS/Glassco/Thermo Fisher Scientific
Glass Beaker -1000ml, 6 pc/pack, LFAS/Glassco/Thermo Fisher Scientific
Glass Beaker –2000ml, 2pc/pack, LFAS/Glassco/Thermo Fisher Scientific
Conical flask—250 ml, 6pc/pack, LFAS/Glassco/Thermo Fisher Scientific
Polycarbonate aluminum anaerobic culture Jar—3.5 lits, Brand: ALPHA CHEM/Glassco/Thermo Fisher Scientific
Metalic anaerobic culture Jar—3.5 lits, ALPHACHEM/Glassco/Thermo Fisher Scientific
Candle Jar –5 liters, BOROSIL/Glassco/Thermo Fisher Scientific
Homogenizer—100 to 1000 ml, Bionicsscientific/REMI/Glassco/BR Biochem
Magnetic stirrer—Capacity-1liter, REMI/Glassco/Thermo Fisher Scientific
Measuring cylinder –1000ml, LABIFIE/Glassco/Thermo Fisher Scientific
Screw Blue Caped Glass reagent bottle—100 ml, 4 pc/pack, Brand: WitegBorosilicated/ABG/Generic
Diamond Pencil—Brand: Micare India Inc/Glassco/Thermo Fisher Scientific
WintrobesHaematocrit tube –10pc/pack, Brand: MLABS/Glassco/Thermo Fisher Scientific
Haemometer—Brand: MLABS/Glassco/Thermo Fisher Scientific
Haemocytometer—Generic/WKM
Fresh wrap aluminum foil –6mtr Pkt, Brand: Fresh wrap/FRESHMETZ
Micropipette Tips—Capacity /Vol.- 1000 μl, Brand:Tarson/Genaxy/Himedia/Glassco
Micropipette Tips—Neutral Colour Vol.- 200 μl, Brand: Tarson/Genaxy/Himedia/Glassco
MicropipetteTips—Neutral Colour Vol.- 100 μl, Brand: Tarson/Genaxy/Himedia/Glassco
1-20 μl natural bulk non sterilized Micropipette Tips—1000 tips/pkt, Brand:Genaxy/Thermo Fisher Scientific /Avantor
Micropipette Tips—Vol.:1-10 μl, Brand: Himedia/Tarson/Genaxy/Thermo Fisher Scientific /Avantor
Micropipette Tips—Neutral Colour*Vol.- 0.5-10 μl, Brand: Himedia/Tarson/Genaxy/Thermo Fisher Scientific /Avantor
100-1000 μl natural bulk beveled non sterilized Micropipette Tips—500 tips/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
0.5-10µl natural racked low retention non sterilized—10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
0.5-20µl natural racked non sterilized—0 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
1-200µl yellow racked beveled non sterilized—10 racks/pk, Brand: Genaxy/Thermo Fisher Scientific /Avantor
100-1000µl Blue racked Beveled Non sterilized—10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
Empty racks for Gen tips 200µl—0 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
Empty racks for tips –1000µl, 10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
Empty racks for tips –5ml to 10ml, 10 /pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
Empty Racks for Eppendorf Style Tips—200µl, 10 racks/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
Click seal Micro Centrifuge –B- Tube-0.6ml pre sterilized, 10×100, Brand: Genaxy/Thermo Fisher Scientific /Avantor
Click seal Micro Centrifuge Tube –B non-sterilized, Attached hinged cap, autoclavable, 1.5 ml, 500/pkt, Brand: Genaxy/Thermo Fisher Scientific /Avantor
Click seal Micro Centrifuge Tube—G*Pre sterilized Attached hinged cap, air tight autoclavable, 2.0 ml,Brand: Genaxy/Thermo Fisher Scientific /Avantor
Click seal Micro Centrifuge Tube—non sterilized, conical bottom, Attached hinged cap, autoclavable, 5.0 ml,Brand: Genaxy/Thermo Fisher Scientific /Avantor
Centrifuge Tube—15 ml, Brand: Genaxy/Thermo Fisher Scientific /Avantor
Centrifuge Tube—50ml, Orange Cap,Non sterile, Autoclavable, Brand: Himedia/Genaxy/Thermo Fisher Scientific /Avantor
Sterile Disposable Petri Plates*--Polystyrene, Optically clear, size : 90 mm x 15 mm, 600pc per Pkt, Brand: Himedia/Genaxy/Thermo Fisher Scientific /Avantor
Cryo tubes –vol.1.8 ML(50/Pkt) , Brand: Genaxy/Thermo Fisher Scientific /Avantor
Blue purple nitrile gloves—medium size, 100per pkt, Brand: Kimberly-clark/Ansell
Micropipette 6-Pack Bundle—Single channel, variable, 0.1-2.5µl/0.5-10µl/2-20µl/10-100µl/20-200µl/100-1000µl and Pipette Caousel, Brand: ThermoFisher Scientific/ Eppendorf/Gilson
Parafilm M Roll—125' Length x 4 width,Brand: Parafilm/Lablink/WKM/Himedia
Parafilm dispenser—Brand: LFAS/Genaxy/Himedia/Glassco
Brown Packaging Paper Roll –0 Inch * 5 Mtr 120 gsm Paper Roll (Set of 1, Brown), Brand: Eco Kraft/Himedia/Glassco
Rubber gloves—00 pcs per box, Brand: Urban Haat/TWENOZ/Himedia
Laboratory mask –100 nos. per box, Brand: KNYA MED/Himedia/Glassco
Test tube stand—3 tier, pc/pack, Brand: Genaxy/Himedia/Glassco
Sample bags (Zipped)—7×10,100 bags per packet, Brand: Bibhu/Genaxy/Himedia/Glassco
Non-absorbent Cotton Wool—Brand: Himedia/Glassco/SR Biotech
Absorbent Cotton Wool—Brand: Himedia/Glassco/SR Biotech
Labeling sticker—A4 size, 100 /pack, Brand: Genaxy/Himedia/Glassco
Filter paper, Students grade—100c, Brand: Genaxy/Himedia/Glassco
Syringe—5 ml,100pc/pack, Brand: Glassco/Meark/BD India Pvt. Ltd/Dispovan
Syringe—2 ml, 100pc/pack, Brand: Glassco/Meark /BD India Pvt. Ltd/Dispovan
Embedding cassettes, Plastic—100 nos./pack,Brand: Harpal sons/Genaxy/Himedia/Glassco
Swab stick—100 pc/Pkt, Brand: Apex International/Himedia/Glassco
Tissue roll—12/Pkt, Brand:Premier/Solimo/ Origami
Kim-wipes—Brand: Kimtech science/BD India Pvt. Ltd
Beaker Tong –12” long , made of Stainless Steel, Brand: COMET/Himedia/Glassco
Autoclavable bio hazardous bag—100pc/pack, Brand: Tarson/Himedia/Glassco
Ice box with chiller—4.7liter, blue lid, Brand: Coleman/Cello/Milton
Spirit lamp, stand and wire combo—Brand: Sciencolab/Genaxy/Glassco
Slide tray—6pc/pack, Brand: Tarson/Genaxy/Himedia/Glassco
Laboratory head caps—50 nos. per box, Brand:Vinayakamart/Genaxy
Sample container –Plastic, 100 pc/box, Brand: Welton/Genaxy/Glassco
Polypropylene wash bottle—250 ml, 2pc/unit, Brand: LABIFIE/Genaxy/Glassco
Cryo- cube box—100 places, 4 pc/pack, Brand: LFAS/Genaxy/Glassco
Inoculation loops—Ni-Cr alloy, 10 Pc/pack, Brand: Generic/Genaxy/Glassco
Slide box—Plastic, 100 slide capacity, Brand: Generic/Glassco
Slide dispenser—Plastic, 50 place, 2 pc/pack,Brand: Tarsons/Glassco
Blood collection tube—With anti-coagulant, blue cap1.8 ml, 100pc/pack, Brand: Next tube/Tar son/BD India Pvt. Ltd.
Mini cooler—For keeping reagents and enzymes. Freeze 00C mini cooler for 24 hours at -50C to -100C, 32 places and capacity 1.5 ml, material- polycarbonate Brand: Borosil/Riviera/Tarson
Sample carrying self-sealing /zip lock poly pouches –600gm (100Pc/Pkt) , Brand: BVSLF
Gloves for OTG/Microwave—One Pair
Silicon Microwave pinch grip—One Pair
Bio Hazard Pedal Dustbin—Green, Yellow and RED,
Romanosky-Giemsa'sstaining solution—500ml, Brand: Himedia/Sigma-Aldrich
Methylene blue—125 ml bottle, Brand: Merck/Thermo Fisher Scientific/Himedia
Formalin—5liter jar, Brand: ISOCHEM/LABOGEN
Leishmen’sstain—125 ml,Brand: APL/Himedia/Merck
Ethanol—5lit jar, Brand: LABOGENS/Himedia/Merck
Methanol—500 ml, Brand: Quali-Tech/Himedia/Merck
Paraffin wax—Melting temperature:56-60˚C, 500 gm container, Brand: LABOGEN/Himedia/Merck
Glycerine—200 gm bottle, Brand: Bhumija Life Sciences/Himedia/Merck
DPX—500ml, Brand: Quali-Tech/Merck/Qualigens
Cedar Wood Oil—250 ml,Brand: AlphaChemika/Himedia/LABOGENS
Xylene—500 ml amber glass bottle,Brand: Himedia/Merck/Glassco
WBC diluting fluid—500ml, Brand: LABOGENS/Himedia/Merck
RBC diluting fluid—500ml, Brand: LABOGENS/Himedia/Merck
Platelet diluting fluid—125ml,Brand: LABOGENS/Himedia/Merck
Mayer's Haematoxyline stain—125ml, Brand: Himedia/Merck/BD India Pvt. Ltd.
Harri'sHaematoxyline stain—125ml,Brand: Himedia/Merck/BD India Pvt. Ltd.
Eosin—2%w/v-125 ml, Brand: Himedia/Merck/BD India Pvt. Ltd.
Eosin Yellow water soluble—25 gram,Brand: Himedia/Merck/BD India Pvt. Ltd.
Hand Sanitizer, liquid hand rub—500ml,X10pc/pkt, Brand: Himedia/Merck/BD India Pvt. Ltd.
Phenyle—5lit jar, Brand: Entergent/Himedia/Merck
Isopropyl alcohol—500 ml,Brand: LABOGENS/Himedia/Merck
Hydrogen peroxide—400ml, Brand: LABOGENS/Himedia/Merck
N/10 Hydrochloric acid—500ml, Brand: ThermoFisher Scientific/Himedia/Merck
Nutrient agar—500gm, Brand:Himedia/Merck/ThermoFisher Scentific
Nutrient broth—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific
Agar powder, Bacteriological—100gm, Brand:Himedia/Merck/Thermo Fisher Scentific
Blood agar base—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific
Brain Heart Infusion(BHI) broth—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific
Brain Heart Infusion(BHI) agar—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific
Mueller Hinton Agar—500gm, Brand:Himedia/Merck/Thermo Fisher Scentific
Gram’s staining kit With allreagents of Gram’s staining -Brand: Himedia/ Merck/Thermo Fisher Scentific
Capsule Staining Kit—Brand:Himedia/Merck/Thermo Fisher Scentific
Anaerobic blood agar plate—50 plates/Pkt, Himedia/Genaxy/Merck
Ornithine decarboxylase broth—100 gm, Brand:Himedia/Genaxy/Borosil
Carbohydrate fermentation kit-Phenol Red Broth Base—100gms,Sucrose– 25gms, Lactose – 25gms, Maltose – 10gms, Inositol – 10gms, Mannitol – 10gms,Galactose – 10gms, Sorbitol – 10gms, Brand: SRL Pvt. Ltd./Himedia/Merck
IMVIC test kit—5 kits/Pkt Each kit performs 10 tests, Himedia/Merck/Thermo Fisher Scientific
Nitrate reagent discs—Twin pack, 1 vial, 50discs/vial, test Brand:Himedia/Thermo Fisher Scientific /Sigma-Aldrich
Rapid Urease test broth—100gm, Brand: Himedia/Thermo Fisher Scientific /Sigma-Aldrich
Oxidase—100 strips, Brand:Merck/Himedia/S Science
Nutrient Gelatin—100gm, Brand: Himedia/Merck/Thermo Fisher Scientific
Sterile glycerol—(40%) AR grade (500ml), Himedia/Merck/Thermo Fisher Scientific
Peptone water—(25×5ml), Himedia/Merck/Thermo Fisher Scientific
Nitrate broth AR grade—100gm, Himedia/Merck/Thermo Fisher Scientific
PenicillinG—10U/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific
Amoxycillin/Clavulenic acid –20/10 mcg per disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific
Cefotaxime –30 mcg/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific
Cefotaxime—5 mcg/disc,100/vial, Himedia/Merck/Thermo Fisher Scientific
Piperacillin / Tazobactam—30/6 mcg/disc,100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Amoxicillin/ Sulbactam—30/15 mcg/disc,100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Ceftriaxone/Tazobactam –30/10 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Amoxycillin/clauvalenic acid—20/10 mcg/Disc,100discs/vial, Brand: Himedia/Merck/Thermo Fisher Scientific
Amikacin –30 mcg/disc 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Gentamicin –10 mcg/disc, 100/vial, Himedia/Merck/Thermo Fisher Scientific
Streptomycin –10 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Azithromycin –15 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Tylosine—15 mcg/dusc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Sulphamethoxazole—25 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Tetracycline –30 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Doxycyclinhydrophloride—30 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Oxytetracyclin—30 mcg/disc, 100disc/vial, Brand: Himedia/Merck/Thermo Fisher Scientific
Levofloxacin –5mcg/disc, 100discs/vial, Brand: Himedia/Merck/Thermo Fisher Scientific
Ofloxacin –5 mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Ciprofloxacin –5mcg/disc, 100discs/vial, Himedia/Merck/Thermo Fisher Scientific
Enrofloxacin—5mcg/disc100discs/vial, Himedia/Merck/Thermo Fisher Scientific
EmeraldAmp® GT PCR Master Mix—800 Rxns(Reactions), Dss Takara/Qiagen/Thermo Fisher Scientific/GCC Biotech
1 kb DNA Ladder—200Rxns, Brand: Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech
100 bp DNA Ladder (Dye Plus)—Brand: Qiagen/Biorad/Thermo Fisher Scientific/ GCC Biotech
Ethidium bromide solution—(10mg/ml), 500 µl/pack, Brand: Himedia/Merck/BD Ind Pvt Ltd./ GCC Biotech
Agarose special, High EEO—100gm, Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech
Diluent for DNA Extraction—500ML, Brand:Himedia/Merck/Thermo Fisher Scientific
Molecular Biology Grade Water(NFW)—500ml, Brand:Himedia/Thermo Fisher Scientific/Qiagen
Magnesium chloride for molecular biology—Molecular work, Brand:Sigma-Aldrich/Calbiochem
Gel loading dye(single)—1ml×5/ pkt, Brand:Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech
Taq DNA polymerase—1U/ µl, Brand:Qiagen/Biorad/Thermo Fisher Scientific
16SrRNA gene Primer For RA--Forward primer—CAGCTTAACTGTAGAACTGC, Reverse primer-- IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech
gyrB Gene primer for RA--Forward primer -- GGCTAAGGCAAGACAAGCTG , Reverse primer—GCAGTTCCTCCTGCAGAGTC, IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech
Ribonuclease Z gene primer--Forward primer—TTACCGACTGATTGCCTTCTAG, Reverse primer--, IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech
TE Buffer 10x—1 Lit,Qiagen/Biorad/Thermo Fisher Scientific/GCC Biotech
16SrRNA gene PCR product sequencing—IDT/Bioserve/Thermo Fisher Scientific/GCC Biotech
Serotype specific strains types serotype—India/ abroad-microbiology Lab
Tris-EDTA buffer solution(pH-8)—100 mL, Sigma-Aldrich/Himedia
GSure® Bacterial Isolation Kit—50 Preparartions, GCC Biotech
10mM dNTP mix, ultrapure—1000 µl, GCC Biotech
BIOAPPS
BIOLAB EQUIPT PRIVATE LIMITED
stage.html
html • 0.05 MB
tech_bid_open.pdf
tech_eval.pdf
fin_bid_open.pdf
boq_comp_chart.xlsx
xlsx
fin_eval.pdf
aoc.pdf
Tap a document below to read it instantly. You can also download everything as a ZIP if you prefer.
details.html
html • 0.03 MB
Download all tender documents and submit your bid
Disclaimer: TenderKart has made every reasonable effort to ensure that the information on this page is accurate and authentic, however it cannot be held liable for any third-party claims or losses or any damages. TenderKart makes no warranty, expressed or implied, as to the results obtained from the use of this information. If you notice any error or omission, please let us know at .