Loading
Loading…
Loading…
Tender Value
₹1.5 L
EMD Value
Exempted
Closing Date
16 Jun 2026, 6:00 pm
P35S Probe
Tnos Probe
FMV Probe
Plant trnl Probe
P35S F Primer
P35S R Primer
Tnos F Primer
Tnos R Primer
FMV F Primer
FMV R Primer
Plant trnl F Primer
Plant trnl R Primer
9381194
GEM/2026/B/7586437
Two Packet Bid
P35S Probe,Tnos Probe,FMV Probe,Plant trnl Probe,P35S F Primer,P35S R Primer,Tnos F Primer,Tnos R P
Ahmadabad, Gujarat
Total value wise evaluation
BOQ
11 documents required · 11 mandatory
3 yrs
₹1 L
₹1 L
10%
Exempted
Yes
26 May 2026
26 May 2026
16 Jun 2026
| Item No | Item Title | Description | Qty | Unit | Consignee | Delivery (days) | Spec |
|---|---|---|---|---|---|---|---|
| 1 | P35S Probe | FAM-CAAAGATGGACCCCCACCCACG-TAMRA | 2 | numbers | Anoop Singh Sengar 380059,Export Inspection Agency-Mumbai, Sub-Office Ahmedabad,(Ministryof Commerceand Industry, Government of India),T.P. Scheme No.38,F.P.No.275, Thaltej, Ahmedabad -380059 (Gujarat) | 15 | - |
| 2 | Tnos Probe | VIC/HEX-ATGGGTTTTTATGATTAGAGTCCCGCAA-TAMRA | 2 | numbers | Anoop Singh Sengar 380059,Export Inspection Agency-Mumbai, Sub-Office Ahmedabad,(Ministryof Commerceand Industry, Government of India),T.P. Scheme No.38,F.P.No.275, Thaltej, Ahmedabad -380059 (Gujarat) | 15 | |
| 3 | FMV Probe | VIC-CTGACAGCCCACTCACTAATGC-TAMRA | 2 | numbers | Anoop Singh Sengar 380059,Export Inspection Agency-Mumbai, Sub-Office Ahmedabad,(Ministryof Commerceand Industry, Government of India),T.P. Scheme No.38,F.P.No.275, Thaltej, Ahmedabad -380059 (Gujarat) | 15 | |
| 4 | Plant trnl Probe | FAM-TTAATTCCAGGGTTTCTCTGAATTTGAAAGTT-TAMRA | 2 | numbers | Anoop Singh Sengar 380059,Export Inspection Agency-Mumbai, Sub-Office Ahmedabad,(Ministryof Commerceand Industry, Government of India),T.P. Scheme No.38,F.P.No.275, Thaltej, Ahmedabad -380059 (Gujarat) | 15 | |
| 5 | P35S F Primer | GCCTCTGCCGACAGTGGT | 2 | numbers | Anoop Singh Sengar 380059,Export Inspection Agency-Mumbai, Sub-Office Ahmedabad,(Ministryof Commerceand Industry, Government of India),T.P. Scheme No.38,F.P.No.275, Thaltej, Ahmedabad -380059 (Gujarat) | 15 | |
| 6 | P35S R Primer | AAGACGTGGTTGGAACGTCTTC | 2 | numbers | Anoop Singh Sengar 380059,Export Inspection Agency-Mumbai, Sub-Office Ahmedabad,(Ministryof Commerceand Industry, Government of India),T.P. Scheme No.38,F.P.No.275, Thaltej, Ahmedabad -380059 (Gujarat) | 15 | - |
| 7 | Tnos F Primer | CATGTAATGCATGACGTTATTTATG | 2 | numbers | Anoop Singh Sengar 380059,Export Inspection Agency-Mumbai, Sub-Office Ahmedabad,(Ministryof Commerceand Industry, Government of India),T.P. Scheme No.38,F.P.No.275, Thaltej, Ahmedabad -380059 (Gujarat) | 15 | |
| 8 | Tnos R Primer | TTGTTTTCTATCGCGTATTAAATGT | 2 | numbers | Anoop Singh Sengar 380059,Export Inspection Agency-Mumbai, Sub-Office Ahmedabad,(Ministryof Commerceand Industry, Government of India),T.P. Scheme No.38,F.P.No.275, Thaltej, Ahmedabad -380059 (Gujarat) | 15 | - |
| 9 | FMV F Primer | CAAAATAACGTGGAAAAGAGCT | 2 | numbers | Anoop Singh Sengar 380059,Export Inspection Agency-Mumbai, Sub-Office Ahmedabad,(Ministryof Commerceand Industry, Government of India),T.P. Scheme No.38,F.P.No.275, Thaltej, Ahmedabad -380059 (Gujarat) | 15 | |
| 10 | FMV R Primer | TCTTTTGTGGTCGTCACTGC | 2 | numbers | Anoop Singh Sengar 380059,Export Inspection Agency-Mumbai, Sub-Office Ahmedabad,(Ministryof Commerceand Industry, Government of India),T.P. Scheme No.38,F.P.No.275, Thaltej, Ahmedabad -380059 (Gujarat) | 15 |
Tap a document below to read it instantly. You can also download everything as a ZIP if you prefer.
bid_9381194.pdf
GEM_BID • 0.14 MB
specification_documents-oligos_2026-05-26-12-37-41_f0de47de93be6e52955a102ecec45f34.pdf
BOQ • 0.15 MB
boq_item_sample_file_2026-05-26-12-37-41_9957a539c16bd635abad097ea51319f8.csv
BOQ • 0.00 MB
gtc.pdf
GEM_OTHER • 0.71 MB
Download all tender documents and submit your bid