Loading
Loading…
Loading…
614 results • Best match
poct point of care test and bio markers Poct Point Of Care Test And Bio Markers ( 1 ) Technical Specifications Specification Specification Name Values Allowed Values Point of Care Test (POCT) Equipment Instrument Shall have multi-analysis platform ... of Test Kits used ...
Regulator For Argon Gas Cylinder, Wooden Extension Board For Industrial Use, With 3 Switches And 3 Sockets 5A/15A, Indicator And Coppe, Halogen Tube Rod 500 W, Halogen Light Fixture, Capacity 500W, Steel Rule, Cup Lock Scaffolding, Size: - 3 Mtrs, ... Penetration Test Kit , ...
poct point of care test and bio markers Poct Point Of Care Test And Bio Markers ( 2 ) Technical Specifications Specification Specification Name Values Allowed Values Point of Care Test (POCT) Equipment Instrument Shall have multi-analysis platform ... of Test Kits used ...
Double hole Punching Machine, Box Index file, Tissue Rolls, SD Card For Camera 64 GB, Field Diary, Magnifier lens, A4 Paper Rim 75gsm, Table Lamp, Fevicol 200gm, Binder Clips 19mm, 32mm, 51mm, Sticky Notes 3x5 Inch, Sticky Notes Flags arrow, Dura ... letter, Glassware cleaning ...
Pottasium Electrode Meril Electrolyte Analyzer, Reference Electrode Meril Electrolyte Analyzer, SypIron with VitaminB12 and Folic Acid Bottle of 200ml, System Pack SGOT Erba Kit 16X44 R23X22ml, CellCleanItemCode120515forSemiAutoHaematologyCellCoun ... IGM Rapid Test Card, ...
Succinate 1000 mg, Inj Teicoplanin 200 mg, Inj Vancomycin CP 500mg, Inj Varicella Vaccine, 0.5 ml Vial Amp PFS, Hepatitis B Vaccine 10 ml Vial Amp PFS, Isoflurane Bottle of 100 ml, Inj Ketamine HCL 50 mg ml Vial of 2 ml, Inj Esmolol 100 mg, 10 ml, ... 25 Test Kit , ... 25 Test Kit , ... Widal Test Kit 20 ...
FGM-001, Mate FGM-002, FGM-03, Mate FGM-04, Mate FGM-05, Mate FGM-06, Mate FGM-07, 3 Pole contractors MNX 300, 3 Pole contractors MNX 40, 3 Pole contractors MNX 32, 3 Pole contractors MNX 9, 3 Pole contractors ML 12, 3 Pole contractors ML 4, 3 Pole ... Water Test Kit BOQ ...
Inj Dexmedetomidine 100 mcg per ml, Sodium Hypochlorite 5percent, Tab and Cap Indomethacin 25 mg, Tab Trihexyphenidyl HCl 2 mg, Inj Phytomenadione Vit K 1 mg per 0.5 ml, Kit for estimation of VDRL Rapid Test of 1 x 25 Test, Tab Amlodipine 10 mg, Antiseptic mouth wash containing sodium fluoride and triclosan bott of 100 ml, Framycetin Sulphate BP 1 percent cream 30 gm, Glycerin Glycerol in bottle of 1 Kg, Silver sulphadiazine 1 percent cream w by v, jar of 500 gms, Tab Cilnidipine 5 mg, Bacillus Clausii 2 billion spores per 5 ml, Tab Antispasmodic containing Mefanamic Acid 250mg and Dicyclomine Hcl 10mg, Tab Trypsin with chymotrypsin, Self-Adhesive Label Roll Size 50 x 25 For Zebra ZD 230, Inj Dicyclomine HCl 20 mg, Tab Oestrogen Conjugated 0.625mg, Inj Oxytocin 5 units per 1.0 ml amp, Tab Vildagliptin 50 mg, Tab Sitagliptin 50mg and Metformin 1000mg, Tab Linagliptin 2.5 mg and Metformin 500 mg, Tab Pioglitazone Hydrochloride 15mg, Cream Luliconazole, tube of 15 gm, Tab Chlordiazepoxide 10mg, Inj Haloperidol 5mg per ml, PT- INR Clot Quant -04 Regent Merilyzer 10 x 2 ML, Cap Clindamycin 300 mg, Tab Nitrofurantoin 100 mg, Tab Thyroxine Sodium 75 mcg, Troponin T Test card, Diclofenac Sodium Suppository 100 mg, Tab Betahistidine 16 mg, Tab Flavidon MR 35 MG Trividon MR 35 MG Trimetazidine, Tab Pentoxyphilline 400mg, Tab Mefenamic acid 250 mg and Tranaxamic Acid 500mg, Tab Sitagliptin Phosphate 50 mg, Tab Pantaprazole 40 mg and Domperidone 10 mg, Syp B Complex bott of 100 ml Multivitamin, Tab Serratiopeptidase 10mg, Syp Cold PCM and Chlorpheniramine and Phenylphrin Bott of 30ml, Syp Paracetamol and Ibuprofen bott of 30ml, Dura Cell AAA, Tab Clindipine 10mg, Tab Ethinyl Estradiol 0.035mg, Cyproterone Acetate 2mg Pack of 21 or 28 Tablets, Venusia Max Moistouring Lotion bott of 500gm, Tab Calcium Carbonate 500mg Tab elemental and Vit-D3-200 IU to 250 IU, System Pack LDH Erba Kit 10 x 44Ml, System Pack Microprotein Erba Kit 10 x 44Ml, System Pack Lipase Erba Kit 10 x 44ml, System Pack Amylase Erba Kit 10 x 44ml, System Pack Norm Erba Kit 1 x 5ml, System Pack Erba Path Kit 1 x 5ml, System Pack Erba Multical Kit 1 X 5Ml, System Pack CKMB Erba Kit 10 x 44Ml, System Pack Erba autowash Kit 10 x 100 ml, Ferr Biot-YG-I FIA Rapid 25 Test, tPSA Biot -YG-I FIA Rapid 25 Test, PRL Biot-YG-I FIA Rapid, FSH Rapid Quantitave Test Flurescence Immunoassay Compatible With Biotime Analyser Model Biot-YG-1 25 Test, Testesterone rapid quantitave Test flurescence immunoassay compatible with biotime analyser model biot-yg-1 25 Test, D-Dimer Biot-YG-I FLA Rapid 25 Test, fPSA Biot -YG-I FIA Rapid 25 Test, CK-MB Biot-YG-I FIARapid 25 Test, EI Standard B 2 x 250 Ml, Anti D RHO Immunoglobulin Monoclonal Human Lyophilised freeze dried vial of 300 per 350 mcg, Dextrose Mono Hydrate for Oral Glucose, Thermal Transfer Wax Type - 112 Ink Outside Size 105 x 300 Bid Details 2/56
mg Tab, Tab Pantoprazole 40mg plus Domperidone 10mg sustained release, Inj Methylergometrine maleate 0 point 2mg 1ml, Inj Atracurium 10mg ml 2 point 5ml, Succinylchloline Chloride 50 mg ml 2 ml Inj, Vecuronium Bromide 4mg ml 1 ml Inj, E D Ciprofl ... Dengue Rapid test kit NS1 ...
Card for OM-511 Hematology Analyser 5P, Mindray CBC 5 Parts Control, Cell Pack Item Code 120543 for Semi Auto Haematology Cell Counter Sodium Chloride 6.38 G L Boric Acid 1.0 G L Sodium Tetraborate 0.2 G L Edta-2K O.2 G L, PT-INR Clot Quant -04 R ... 1X25 Test , ... Test, Kit for ...
Custom DNA Synthesis of Primers 25 nmol, Prime Script 1st strand cDNA Synthesis Kit 50 reactions, TB Green Pre Mix Ex Taq II Tli RNAse H Plus, RNAiso plus Total RNA extraction reagent, Amylase from Bacillus licheniforms, Amyloglucosidase from Aspergillus niger lyophilized Powder 70 U mg, Glucose Oxidase form Aspergillus niger type VII lyophilized powder 100000 units g solid without added oxygen, Peroxidase from horseradish type II essentially salt free lyophilized powder 150 250 units mg solid using pyrogallol, Primers Forward Revers Total Base 1249, Fish Immunoglobulin M Ig ELISA kit 96T, Superoxide Dismutase SOD ELISA kit, Fish lysozyme renal amyloidosis LZM ELISA kit, Fish Interleukin 6 IL 6 ELISA Kit, Fish Cortisol ELISA Kit, Forward Primers, Reverse Primer, Taq DNA Polymerase, EZAssay Antioxidant activity estimation kit CUPRAC 200 tests, Azo M Protein Azo Casein, EZdetect PCR kit for Mycoplasma detection Based on 16S 23S rRNA spacer region, Trypsin inhibitor powder source Soyabean Cell culture tested Activity 7000BAEE units of inhibition mg, COIF1 5TCAACCAACCACAAGACATTGGCAC3 26 nucleotides, COIR1 5TAGACTTCTGGGTGCCAAAGAATCA3 26 nucleotides, M151 5AACCCGGCTTTCGGCAGCA3 20 nucleotides, M152 5CGGGGCGGGGTTGTGAGAT3 20 nucleotides, IHN UP F 5AGAGATCCCTACACCAGAGAC 3 21 nucleotides, IHN UP R 5AGAGATCCCTACACAGAGAC 3 21 nucleotides, VN F 5ATGGAAGGAGGAATCGTGAAGCG 3 24 nucleotides, VN R 5 GCGGTGAAGTGCTCAGTTCCC 3 22 nucleotides, IPN F 5 GTGCTGGCCACAACGACAAC 3 21 nucleotides, IPN R 5 AATTGGTCTGCCGTTCCTA 3 19 nucleotides, ISAoic F 5 GGCTATCTACCAT AACGAAT 3 21 nucleotides, ISAoic R 5 GCCAAGTGTAAGTGCACTCC 3 21 nucleotides, Bench Top 1kb DNA Ladder, Bench Top 100bp DNA Ladder, Bench Top PCR Marker, Taq DNA Polymerase recombinant 5U uL, Quick CIP 1000 units with buffer, T4 DNA Ligase 20000 units, ProtoScript II First Strand cDNA Synthesis Kit 30 reactions, Q5 High Fidelity 2X Master Mix 100 reactions, OneTaq 2X Master Mix with Standard Buffer 100 reactions, Synthetic peptides, SpectraDrop 24 Kit, Easy Yeast Plasmid Isolation Kit 50 rxns, Quick Easy Yeast Transformation Mix 20rxn, Western BLoT Immuno Booster PF 250ml, Western BLoT Blocking Buffer Protein Free 500ml, FastDigest ApaI 300rxn, FastDigest BamHI 800rxn, FastDigest BgIII 100rxn, FastDigest EcoRI 800rxn, FastDigest EcoRV Eco32I 200 rxn, FastDigest HindIII 800rxn, FastDigest KpnI 300rxn, FastDigest NcoI 20rxn, FastDigest Ndel 100 rxn, FastDigest Nhel 50 rxn, FastDigest Notl 50 rxn, FastDigest SaII 200rxn, FastDigest SmaI 100 rxn, FastDigest SacI 100 rxn, FastDigest XbaI 300 rxn, FastDigest XhoI 400 rxn, FastDigest value pack, Synthetic peptide, MRGSH 011FW, MRGSH 011RV, SHRV 1 F, SHRV 1 R, SHRV 2 F, SHRV 2 R, SHRV IPC2 fwd, SHRV IPC2 rev, Bacterial Genome Sequencing
Total and direct, Kit for estimation of CKMB, Kit for estimation of LDH, GGT Kit of 2 x 20 Ml, Prothrombin time reagents to give control of 10 14 secs bott of 5 ml, Bio Lab C Reactive Protein CRP Kit Latex Agglutination Slide Method, RA Factor Kit, Strips Albumin and glucose bottle of 100 strips, Keto diastix bott of 50 strips, Drabkins solution Diluting solution for haemoglobin estimation by cyanmet haemoglobin method, Stain Leishmans, Vaccum blood collection tubes Sodium Fluoride 3ml, Vaccum blood collection tubes with needles EDTA 2ml per 3ml, Vaccum blood collection tubes with needles Sterile tube with gel 2ml per 5ml, D dimer, Multistix, Micropipettes, tips for 1 200 ul, tips for 500 1000 ul, Glucose strips Accuchek Active bott of 50 strips One Glucometer Free on Every 10 Bott, Glucose strips Dr Morepen bott of 50 strips, Syringe disposable, plastic, sterile, 2 ml with needle, 5 ml with needle, Syringe dosposable, plastic sterile, 10 ml with needle, Syringe disposable 20 ml, ECG Electrodes Disposable, Supraglottic device with non inflatable cuff and gastric drain port i gel for size 4, 5, Hand Gloves, size 6 1 per 2 pair of, size 7 pair of, size 7 1 per 2 pair of, Adhesive plaster Zinc oxide 7.5 cm X 5 mtr, Adhesive Plaster Micro porous tape 2 inches box of 6, Adhesive Plaster Micro porous tape 3 inches box of 4, Bandage, Plaster of Paris 10 cm x 3 metres, Set plasma blood saline giving plastic disposable presterilised pyrogen free complete with airline and nylon filter, Glucose solution 5 Percentage in non toxic disposable plastic bott of 500ml FFS or equivalent technology, Sodium lactate compound solution Ringer lactate solution in nontoxic disposable plastic bottle of 500ml FFS or equivalent technology, Normal saline 100 ml self collapsible pressure infusion having separate administration port, with recessed membrane and plastic sterility barrier, self sealing inj port, no air vent required, Normal saline 500 ml self collapsible pressure infusion having separate administration port, with recessed membrane and plastic sterility barrier self sealing inj port, Glucose saline isotonic solution in non toxic disposable plastic bott of 500ml FFS or equivalent technology, NiTi Spreader 21mm 10 to 40, NiTi Spreader 25mm 10 to 40, Lignocaine 100 mg and Ethanol 28 Percentage v per v spray container of 500 ml, Iso propanol 60 to 65 Percentage and Benzalkonium Chloride Skin Disinfectant 63gm per 0.025 gm in 100 gm, Ibuprofen 200 mg Tab, Paracetamol 325mg and Ibuprofen 400mg Tab, Ketorolac 10 mg Tab, Diazepam 10 mg, 2 ml Inj, Phenobarbitone Sodium 200 mg, 1 ml Inj, Metronidazole 400 mg, Tab, Silver sulphadiazine 1 Percentage cream w per v tube of 25 gm, Tab Methylcobalamine 1500 mcg, Atorvastatin 20 mg Tab, Calamine 8 Percent and Aloe vera gel 10 Percent and light liquid parafin 10 Percent lotion bott of 100 ml, Oint Povidone Iodine 5 Percentage tube of 15 Gm, Hydrogen peroxide solution with stabilizer IP 20 volume 500 ml bott, Antacid chewable containing AI OH 3 300mg, Mg Silicate 25 mg and Simethicone 25 mg or Megaldrate 480mg and Simethicone 20mg, Antacid Gel each 5ml containing dried Aluminium Hydroxide gel IP 250mg, Magnesium hydroxide NF 250mg and Methyl Polysiloxane 50mg Bottle of 170 ml, Dicyclomine HCL IP 20 mgand Paracetamol IP 500 mg Tab, Insulin Premixed biphasic 40 IU per ml 30 Percentage human neutral plus 70 Percentage human isophane insulin, 10 ml Inj, Metformin 0.5g Tab, Mirtazapine 15 mg Tab, Levo Salbutamol aerosol
vit B12 12 point 5mg per, Syp Sucralfate 1000mg per 10ml per Oxetacaine 10mg per 10ml Bott of 100ml, Ipratropium Bromide Respirator Soln 500mcg per 2ml respule, Bromhexine Syp 5 ml containing 4 mg of Bromhexine HCL bott of 100 ml, Powder Dextrose ... electrolyte reagent per ...
180 mg Tab, Ketoconazole 2 percent plus Zinc Pyrithione 1 percent bott of 60ml, Cap Isotretinoin 20mg, Terbinafine 1 percent cream of tube of 10gm, Povidone Iodine 5 percent Ointment 250gm jar, Chloroxylenol solution bott of 1ltr, Povidone Iodine ... Electrolyte Reagent Pack ...